Jatropha Genome Database

JcCB0353641.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0353641.10 + phase: 0 
         (189 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30170.m013651 branched-chain amino acid aminotransferase, putative    127   2e-29

>30170.m013651 branched-chain amino acid aminotransferase, putative
          Length = 1323

 Score =  127 bits (64), Expect = 2e-29
 Identities = 127/148 (85%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgtgctacgaggtgaaatgctcgagttgcggcaaaacgacctggtgtggttgcggtagg 60
           ||||||||||||||||||||||||||||||||||| || | |||| | ||||| || |||
Sbjct: 1   atgtgctacgaggtgaaatgctcgagttgcggcaagactagctggggaggttgtggaagg 60

                                                                       
Query: 61  catgtgcgctctgtttataagcgcatcccgcaaggccaacactgtctttgcaatggatgg 120
           ||||| |  |||||||| || || ||||| |||||||||||||||||||||  ||  |||
Sbjct: 61  catgtcccttctgtttacaaccgtatccctcaaggccaacactgtctttgccgtgcttgg 120

                                       
Query: 121 cctggcgttgatcctaataatcccaacg 148
           ||||| || |||||||||||||| ||||
Sbjct: 121 cctggtgtcgatcctaataatcctaacg 148