Jatropha Genome Database

JcCB0341321.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0341321.20 - phase: 0 /partial
         (345 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

28966.m000547 Cysteine protease ATG4B, putative                       232   1e-60

>28966.m000547 Cysteine protease ATG4B, putative
          Length = 1470

 Score =  232 bits (117), Expect = 1e-60
 Identities = 195/221 (88%)
 Strand = Plus / Plus

                                                                        
Query: 1    gtggtcaatattagcagagatggcataggggctgatacttcatcttaccacagcgatttc 60
            |||||||| ||| ||||||||| ||||| |||||||||||||||||||||||||||  ||
Sbjct: 1111 gtggtcaacattggcagagatgacatagaggctgatacttcatcttaccacagcgacatc 1170

                                                                        
Query: 61   ataaggcacattcctctggaatccattgatccatcattggcaattggattttattgtcga 120
             || |||| || |||||| | || |||||||||||||||||||||||||||||||| |||
Sbjct: 1171 gtacggcatatacctctgcactcaattgatccatcattggcaattggattttattgccga 1230

                                                                        
Query: 121  gacaaagatgattttgatgaattctgttttctggcatcaaagctggcagatgactctcat 180
            ||||||||||||||||||||||||||| | |||||||| ||||||||||||||||| || 
Sbjct: 1231 gacaaagatgattttgatgaattctgtctgctggcatccaagctggcagatgactcgcag 1290

                                                     
Query: 181  ggggcacctttgtttactgtggctcattcccataaattgcc 221
            || || || || |||||||||||||| |  |||||||||||
Sbjct: 1291 ggtgcgccgttatttactgtggctcactgtcataaattgcc 1331