Jatropha Genome Database

JcCB0340941.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0340941.10 + phase: 0 
         (318 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30027.m000821 cytoplasmic dynein light chain, putative                115   2e-25

>30027.m000821 cytoplasmic dynein light chain, putative
          Length = 339

 Score =  115 bits (58), Expect = 2e-25
 Identities = 121/142 (85%)
 Strand = Plus / Plus

                                                                       
Query: 5   tagaaggtaaagctgttgttggtgagactgacatgcttcaaaccatgcagcaggatgcac 64
           ||||||| ||||| |||||||||||||| |||||||||||||||||||| || |||||||
Sbjct: 5   tagaaggcaaagcagttgttggtgagaccgacatgcttcaaaccatgcaacaagatgcac 64

                                                                       
Query: 65  ttcacttagctgcaaaggcccttgatatttttgatgtcacggagtccactgatattgccc 124
           || |  | ||||| || ||||| ||| | |||||||| || ||| | ||||| |||||||
Sbjct: 65  ttgatgttgctgctaaagccctagatttctttgatgttaccgaggctactgagattgccc 124

                                 
Query: 125 gctttattaaaaaggattttga 146
           | |||||||||||||| |||||
Sbjct: 125 gttttattaaaaaggaatttga 146