Jatropha Genome Database

JcCB0336621.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0336621.10 - phase: 0 /partial
         (421 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30142.m000632 Rho GTPase activator, putative                          498   e-140
29908.m006240 conserved hypothetical protein                           92   3e-18

>30142.m000632 Rho GTPase activator, putative
          Length = 2466

 Score =  498 bits (251), Expect = e-140
 Identities = 379/421 (90%), Gaps = 3/421 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagagtgctctgccgcaaagaggtggtgaagtaaatttaactttggggggcattgac 60
           ||||||||||| || || ||| ||||||||||||||||| ||||||| ||||||||||||
Sbjct: 1   atgcagagtgccctaccacaacgaggtggtgaagtaaatctaactttagggggcattgac 60

                                                                       
Query: 61  ttgaataattcagggagtgttgttgtcagagaggataagaagttattaactgtcttgttt 120
           ||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 61  ttgaataattctgggagtgttgttgtcagagaagataagaagttattaactgtcttgttt 120

                                                                       
Query: 121 cctgatggacgtgatgggcgagcattcaccctcaaggctgagacgtccgaagatttgtat 180
           |||||||| |||||||||||||||||||| |||||||||||||| || || ||||| |||
Sbjct: 121 cctgatgggcgtgatgggcgagcattcactctcaaggctgagacatcagaggatttatat 180

                                                                       
Query: 181 gagtggaagacagccctagaacatgcccttgcgcaagcaccaagtgctgcccttgttatg 240
           |||||||| || || || |||||||||||||| |||||||||||||| |||||||| |||
Sbjct: 181 gagtggaaaacggctcttgaacatgcccttgcacaagcaccaagtgcggcccttgtcatg 240

                                                                       
Query: 241 ggacataatggaatttttcgaagtgatacaaatgaagcaattgaaggatctttccatcaa 300
           ||||||||||| |||||||| |||||||||||||| ||   |||||| ||||| ||||||
Sbjct: 241 ggacataatgggatttttcgcagtgatacaaatgaggc---tgaagggtcttttcatcaa 297

                                                                       
Query: 301 tggagggataaacgtcctgttaaatcattggttgttggaaggccaattttgcttgccctt 360
           ||||||||||||||||||||||| || |||||||||||||| || |||||||||||||||
Sbjct: 298 tggagggataaacgtcctgttaagtctttggttgttggaagaccgattttgcttgccctt 357

                                                                       
Query: 361 gaagatattgatggaggaccatcattcctcgagaaagctcttagatttcttgagaaattt 420
           |||||||||||||| || ||||| || || ||||| |||||| ||||||| |||| ||||
Sbjct: 358 gaagatattgatgggggtccatcttttcttgagaaggctcttcgatttctagagagattt 417

            
Query: 421 g 421
           |
Sbjct: 418 g 418


>29908.m006240 conserved hypothetical protein
          Length = 2943

 Score = 91.7 bits (46), Expect = 3e-18
 Identities = 112/134 (83%)
 Strand = Plus / Plus

                                                                       
Query: 118 tttcctgatggacgtgatgggcgagcattcaccctcaaggctgagacgtccgaagatttg 177
           ||||||||||| |||||||||||||| ||||| || |||||||| |||   |||||||| 
Sbjct: 367 tttcctgatggccgtgatgggcgagctttcacgcttaaggctgaaacgatggaagattta 426

                                                                       
Query: 178 tatgagtggaagacagccctagaacatgcccttgcgcaagcaccaagtgctgcccttgtt 237
           ||||| |||||||| ||||| ||  ||||  | || ||||||||||||||||| ||||| 
Sbjct: 427 tatgattggaagactgcccttgagaatgctttggcacaagcaccaagtgctgcacttgtg 486

                         
Query: 238 atgggacataatgg 251
           ||||| || |||||
Sbjct: 487 atggggcaaaatgg 500