Jatropha Genome Database

JcCB0307081.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0307081.10 - phase: 0 /partial
         (816 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

27561.m000297 UDP-glucuronosyltransferase, putative                    68   9e-11
27561.m000296 UDP-glucuronosyltransferase, putative                    68   9e-11
29806.m000964 UDP-glucuronosyltransferase, putative                    58   9e-08

>27561.m000297 UDP-glucuronosyltransferase, putative
          Length = 1215

 Score = 67.9 bits (34), Expect = 9e-11
 Identities = 52/58 (89%)
 Strand = Plus / Plus

                                                                     
Query: 310 aaagagtttgcatggggacttgcaaatagtaaacatccatttttgtggataattaggc 367
           ||||| ||||||||||| ||||| ||||| ||||| ||||||||||||||||| ||||
Sbjct: 778 aaagaatttgcatggggccttgctaatagcaaacacccatttttgtggataataaggc 835


>27561.m000296 UDP-glucuronosyltransferase, putative
          Length = 1416

 Score = 67.9 bits (34), Expect = 9e-11
 Identities = 52/58 (89%)
 Strand = Plus / Plus

                                                                     
Query: 310 aaagagtttgcatggggacttgcaaatagtaaacatccatttttgtggataattaggc 367
           ||||| ||||||||||| ||||| ||||| ||||| ||||||||||||||||| ||||
Sbjct: 934 aaagaatttgcatggggccttgctaatagcaaacacccatttttgtggataataaggc 991


>29806.m000964 UDP-glucuronosyltransferase, putative
          Length = 1425

 Score = 58.0 bits (29), Expect = 9e-08
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 317 ttgcatggggacttgcaaatagtaaacatccatttttgtggataattaggcct 369
           |||| ||||||||||| ||||| ||| || ||||||||||| |||||||||||
Sbjct: 932 ttgcttggggacttgctaatagcaaatattcatttttgtgggtaattaggcct 984