Jatropha Genome Database
- JcCB0303641.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0303641.10 - phase: 0 /partial
(448 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
30064.m000484 r2r3-myb transcription factor, putative 210 5e-54
>30064.m000484 r2r3-myb transcription factor, putative
Length = 426
Score = 210 bits (106), Expect = 5e-54
Identities = 217/254 (85%)
Strand = Plus / Plus
Query: 177 tttaaagaaagggccgtggacggcggaggaggatgcgatactggtggattatgtgaggaa 236
||||||||| ||||||||||| || ||||||||||| ||| |||| || |||||||| ||
Sbjct: 162 tttaaagaaggggccgtggactgctgaggaggatgctatattggtagaatatgtgagaaa 221
Query: 237 acatggtgaaggaaattggaatgcggtgcagagacattctgggttgtctcgttgtggaaa 296
|||||||||||| ||||||||||| ||||| || ||||| || ||| |||||||||||||
Sbjct: 222 acatggtgaagggaattggaatgcagtgcaaaggcattcaggattggctcgttgtggaaa 281
Query: 297 aagttgcagacttcggtgggctaatcacctccggcctaatcttaaaaaaggcgcattctc 356
||||| || ||||| |||||||| || | | |||||||||||||| || || |||||
Sbjct: 282 gagttgtaggcttcgttgggctaaccatttaagacctaatcttaaaaagggtgccttctc 341
Query: 357 gccggaagaggagaggcttattgttgagttgcacgctaaatttggcaacaaatgggctcg 416
|| ||||| ||||| || ||||||||| | || ||||| ||||||||||||||||||||
Sbjct: 342 tcctgaagaagagagactcattgttgagctacatgctaagtttggcaacaaatgggctcg 401
Query: 417 catggctagtctgc 430
||||||||||||||
Sbjct: 402 catggctagtctgc 415