Jatropha Genome Database

JcCB0294291.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0294291.10 - phase: 0 /partial
         (514 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30169.m006482 thump domain protein, putative                          115   3e-25

>30169.m006482 thump domain protein, putative
          Length = 1149

 Score =  115 bits (58), Expect = 3e-25
 Identities = 94/106 (88%)
 Strand = Plus / Plus

                                                                       
Query: 407 tccatgaaaagatggaagagaaatctgttgataagctgattgaagatgaactcaaagaac 466
           ||||||||||| ||||  ||| |||  |||||||||| ||||||||||||||||| ||||
Sbjct: 590 tccatgaaaaggtggagcagagatccattgataagcttattgaagatgaactcaaggaac 649

                                                         
Query: 467 ttggggataagagtaagaggcgctttgcgaatcttgattcaggttg 512
           | || ||||||||||||||||||||| |||| ||||||||||||||
Sbjct: 650 tgggagataagagtaagaggcgctttacgaaccttgattcaggttg 695



 Score = 75.8 bits (38), Expect = 2e-13
 Identities = 79/92 (85%), Gaps = 3/92 (3%)
 Strand = Plus / Plus

                                                                       
Query: 4   tatgaggagctggtccatggaaaggatacaagtgtggatcttgcagaattgcctaataaa 63
           ||||| ||||| ||||||| ||||||||| |||||| | ||||   | |||||||| |||
Sbjct: 199 tatgaagagctagtccatgcaaaggatacgagtgtgaagcttg---agttgcctaaaaaa 255

                                           
Query: 64  cctttaaataaaaagatcaagtttgtatattc 95
           |||| || ||||||||||||||||||||||||
Sbjct: 256 ccttcaagtaaaaagatcaagtttgtatattc 287