Jatropha Genome Database

JcCB0293861.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0293861.10 - phase: 0 /partial
         (298 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30169.m006422 ADP,ATP carrier protein, putative                        82   2e-15
30169.m006421 ADP,ATP carrier protein, putative                        62   2e-09

>30169.m006422 ADP,ATP carrier protein, putative
          Length = 1179

 Score = 81.8 bits (41), Expect = 2e-15
 Identities = 65/73 (89%)
 Strand = Plus / Plus

                                                                       
Query: 226 ccatcagagaaaggcattgctggcttcgctttagattttcttatgggaggagtttctgca 285
           ||||| ||||||||  ||||| |||| |||  ||||||||||||||| ||||||||||||
Sbjct: 250 ccatcggagaaagggtttgctagctttgctacagattttcttatgggtggagtttctgca 309

                        
Query: 286 gctgtgtccaaaa 298
           |||||||||||||
Sbjct: 310 gctgtgtccaaaa 322



 Score = 63.9 bits (32), Expect = 5e-10
 Identities = 74/88 (84%)
 Strand = Plus / Plus

                                                                      
Query: 1  atggctgatcggcaacagtacccatctatcacgcaaaaggttgctggccaggttcatctc 60
          ||||||||| |||| |||||||||||| ||| ||| ||||| ||  ||||| | ||||| 
Sbjct: 1  atggctgataggcaccagtacccatctctcatgcagaaggtggccagccagatccatctt 60

                                      
Query: 61 agttctatcttgtcccatgatgttcaat 88
          ||||||| | | ||||||||||||||||
Sbjct: 61 agttctagcctatcccatgatgttcaat 88


>30169.m006421 ADP,ATP carrier protein, putative
          Length = 1092

 Score = 61.9 bits (31), Expect = 2e-09
 Identities = 64/75 (85%)
 Strand = Plus / Plus

                                                                       
Query: 224 ccccatcagagaaaggcattgctggcttcgctttagattttcttatgggaggagtttctg 283
           ||||||||||||||||  | || || || ||| |||||||| ||||||| |||||||| |
Sbjct: 161 ccccatcagagaaagggctagcaggatttgctgtagattttgttatgggtggagtttccg 220

                          
Query: 284 cagctgtgtccaaaa 298
           || ||||||||||||
Sbjct: 221 caactgtgtccaaaa 235