Jatropha Genome Database

JcCB0293691.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0293691.10 - phase: 0 /partial
         (372 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

27446.m000477 acetylornithine aminotransferase, putative              244   3e-64
30169.m006332 acetylornithine aminotransferase, putative               84   7e-16

>27446.m000477 acetylornithine aminotransferase, putative
          Length = 843

 Score =  244 bits (123), Expect = 3e-64
 Identities = 210/239 (87%)
 Strand = Plus / Plus

                                                                       
Query: 133 ttgaagagcaaagaagtgatggagatagaggcgaaggtgctggtggggacatatgcaagg 192
           ||||||||||| ||||| || || || || || ||||| || ||||| || |||||||| 
Sbjct: 136 ttgaagagcaaggaagtaatagaaatggaagcaaaggttctagtgggtacttatgcaaga 195

                                                                       
Query: 193 aacccgctagttctctccagtggcaaaggttgtaaattgtatgatcctgaagggcgagag 252
           |||||  |||||||||| ||||||||||| |||||||| || ||||||||||| | ||||
Sbjct: 196 aacccattagttctctctagtggcaaaggctgtaaattatacgatcctgaaggacaagag 255

                                                                       
Query: 253 tatttggactgtacctccggaatcgcagtcaacgctctcggccacggcgatcctgattgg 312
           ||| ||||||| ||| |||| ||||| |||||||| ||||||||||||||||||||||||
Sbjct: 256 tatctggactgcaccgccggtatcgcggtcaacgcgctcggccacggcgatcctgattgg 315

                                                                      
Query: 313 gtccgggcggttacagagcaagccaatttgcttacgcatgttagtaatgtctattattc 371
           || ||||| |||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 316 gtgcgggctgttacagagcaagccaatttgcttacccatgttagtaatgtctattattc 374


>30169.m006332 acetylornithine aminotransferase, putative
          Length = 1413

 Score = 83.8 bits (42), Expect = 7e-16
 Identities = 48/50 (96%)
 Strand = Plus / Plus

                                                             
Query: 211 agtggcaaaggttgtaaattgtatgatcctgaagggcgagagtatttgga 260
           |||||||||||||||||||||||||||  |||||||||||||||||||||
Sbjct: 268 agtggcaaaggttgtaaattgtatgatgttgaagggcgagagtatttgga 317