Jatropha Genome Database

JcCB0293081.10
Show Alignment: 
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0293081.10 + phase: 0 /partial/short
         (149 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30138.m003939 mads box protein, putative                              111   1e-24
30147.m014133 mads box protein, putative                               88   2e-17
30174.m008934 mads box protein, putative                               76   6e-14
30170.m013776 mads box protein, putative                               70   4e-12
29838.m001690 mads box protein, putative                               54   2e-07

>30138.m003939 mads box protein, putative
          Length = 735

 Score =  111 bits (56), Expect = 1e-24
 Identities = 113/132 (85%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggggagaggtagggttgagttgaagagaattgaaaacaagatcaacaggcaagttacc 60
           |||||||||||||||||| || |||||||||||||||||||||| || |||||||| |||
Sbjct: 1   atggggagaggtagggttcagctgaagagaattgaaaacaagattaataggcaagtgacc 60

                                                                       
Query: 61  tttgcaaagagaagaaatgggcttttgaagaaagcctatgagctttccgttctttgtgat 120
           ||| |||| |||||   |||  | |||||||||||| ||||| | || |||||||| |||
Sbjct: 61  ttttcaaaaagaagggctggattgttgaagaaagcccatgagatctctgttctttgcgat 120

                       
Query: 121 gctgaggttgct 132
           ||||| ||||||
Sbjct: 121 gctgaagttgct 132


>30147.m014133 mads box protein, putative
          Length = 642

 Score = 87.7 bits (44), Expect = 2e-17
 Identities = 74/84 (88%)
 Strand = Plus / Plus

                                                                       
Query: 48  caggcaagttacctttgcaaagagaagaaatgggcttttgaagaaagcctatgagctttc 107
           ||||||||| |||||  ||||| ||||||||||||||||||||||||| |||||||| ||
Sbjct: 48  caggcaagtgaccttctcaaagcgaagaaatgggcttttgaagaaagcttatgagctatc 107

                                   
Query: 108 cgttctttgtgatgctgaggttgc 131
            ||||| |||||||| || |||||
Sbjct: 108 agttctatgtgatgcagaagttgc 131


>30174.m008934 mads box protein, putative
          Length = 735

 Score = 75.8 bits (38), Expect = 6e-14
 Identities = 119/146 (81%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggggagaggtagggttgagttgaagagaattgaaaacaagatcaacaggcaagttacc 60
           ||||| ||||| || || ||||||||||| || |||||||| |||||  | ||||| |||
Sbjct: 1   atgggaagaggaagagtagagttgaagaggatagaaaacaaaatcaatcgccaagtgacc 60

                                                                       
Query: 61  tttgcaaagagaagaaatgggcttttgaagaaagcctatgagctttccgttctttgtgat 120
           ||  | || || || |||||  | ||||| ||||| |||||||| || || |||||||||
Sbjct: 61  ttctctaaaaggaggaatggattgttgaaaaaagcttatgagctgtctgtgctttgtgat 120

                                     
Query: 121 gctgaggttgctctcatcatcttctc 146
           |||||||||||||| || ||||||||
Sbjct: 121 gctgaggttgctcttattatcttctc 146


>30170.m013776 mads box protein, putative
          Length = 693

 Score = 69.9 bits (35), Expect = 4e-12
 Identities = 80/95 (84%)
 Strand = Plus / Plus

                                                                       
Query: 46  aacaggcaagttacctttgcaaagagaagaaatgggcttttgaagaaagcctatgagctt 105
           ||||||||||| |||||  | || || |||||||||||| | |||||||| ||||| |||
Sbjct: 46  aacaggcaagtcaccttctctaaaaggagaaatgggcttatcaagaaagcttatgaactt 105

                                              
Query: 106 tccgttctttgtgatgctgaggttgctctcatcat 140
           || ||||| ||||||| ||| || |||||||||||
Sbjct: 106 tctgttctctgtgatgttgatgtagctctcatcat 140


>29838.m001690 mads box protein, putative
          Length = 186

 Score = 54.0 bits (27), Expect = 2e-07
 Identities = 63/75 (84%)
 Strand = Plus / Plus

                                                                       
Query: 52  caagttacctttgcaaagagaagaaatgggcttttgaagaaagcctatgagctttccgtt 111
           ||||| || ||| ||||||||||||  |||||||| |||||||| ||||| || ||   |
Sbjct: 52  caagtgactttttcaaagagaagaagagggcttttcaagaaagcttatgaactatcaact 111

                          
Query: 112 ctttgtgatgctgag 126
           |||||||||||||||
Sbjct: 112 ctttgtgatgctgag 126