Jatropha Genome Database
- JcCB0293081.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0293081.10 + phase: 0 /partial/short
(149 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
30138.m003939 mads box protein, putative 111 1e-24
30147.m014133 mads box protein, putative 88 2e-17
30174.m008934 mads box protein, putative 76 6e-14
30170.m013776 mads box protein, putative 70 4e-12
29838.m001690 mads box protein, putative 54 2e-07
>30138.m003939 mads box protein, putative
Length = 735
Score = 111 bits (56), Expect = 1e-24
Identities = 113/132 (85%)
Strand = Plus / Plus
Query: 1 atggggagaggtagggttgagttgaagagaattgaaaacaagatcaacaggcaagttacc 60
|||||||||||||||||| || |||||||||||||||||||||| || |||||||| |||
Sbjct: 1 atggggagaggtagggttcagctgaagagaattgaaaacaagattaataggcaagtgacc 60
Query: 61 tttgcaaagagaagaaatgggcttttgaagaaagcctatgagctttccgttctttgtgat 120
||| |||| ||||| ||| | |||||||||||| ||||| | || |||||||| |||
Sbjct: 61 ttttcaaaaagaagggctggattgttgaagaaagcccatgagatctctgttctttgcgat 120
Query: 121 gctgaggttgct 132
||||| ||||||
Sbjct: 121 gctgaagttgct 132
>30147.m014133 mads box protein, putative
Length = 642
Score = 87.7 bits (44), Expect = 2e-17
Identities = 74/84 (88%)
Strand = Plus / Plus
Query: 48 caggcaagttacctttgcaaagagaagaaatgggcttttgaagaaagcctatgagctttc 107
||||||||| ||||| ||||| ||||||||||||||||||||||||| |||||||| ||
Sbjct: 48 caggcaagtgaccttctcaaagcgaagaaatgggcttttgaagaaagcttatgagctatc 107
Query: 108 cgttctttgtgatgctgaggttgc 131
||||| |||||||| || |||||
Sbjct: 108 agttctatgtgatgcagaagttgc 131
>30174.m008934 mads box protein, putative
Length = 735
Score = 75.8 bits (38), Expect = 6e-14
Identities = 119/146 (81%)
Strand = Plus / Plus
Query: 1 atggggagaggtagggttgagttgaagagaattgaaaacaagatcaacaggcaagttacc 60
||||| ||||| || || ||||||||||| || |||||||| ||||| | ||||| |||
Sbjct: 1 atgggaagaggaagagtagagttgaagaggatagaaaacaaaatcaatcgccaagtgacc 60
Query: 61 tttgcaaagagaagaaatgggcttttgaagaaagcctatgagctttccgttctttgtgat 120
|| | || || || ||||| | ||||| ||||| |||||||| || || |||||||||
Sbjct: 61 ttctctaaaaggaggaatggattgttgaaaaaagcttatgagctgtctgtgctttgtgat 120
Query: 121 gctgaggttgctctcatcatcttctc 146
|||||||||||||| || ||||||||
Sbjct: 121 gctgaggttgctcttattatcttctc 146
>30170.m013776 mads box protein, putative
Length = 693
Score = 69.9 bits (35), Expect = 4e-12
Identities = 80/95 (84%)
Strand = Plus / Plus
Query: 46 aacaggcaagttacctttgcaaagagaagaaatgggcttttgaagaaagcctatgagctt 105
||||||||||| ||||| | || || |||||||||||| | |||||||| ||||| |||
Sbjct: 46 aacaggcaagtcaccttctctaaaaggagaaatgggcttatcaagaaagcttatgaactt 105
Query: 106 tccgttctttgtgatgctgaggttgctctcatcat 140
|| ||||| ||||||| ||| || |||||||||||
Sbjct: 106 tctgttctctgtgatgttgatgtagctctcatcat 140
>29838.m001690 mads box protein, putative
Length = 186
Score = 54.0 bits (27), Expect = 2e-07
Identities = 63/75 (84%)
Strand = Plus / Plus
Query: 52 caagttacctttgcaaagagaagaaatgggcttttgaagaaagcctatgagctttccgtt 111
||||| || ||| |||||||||||| |||||||| |||||||| ||||| || || |
Sbjct: 52 caagtgactttttcaaagagaagaagagggcttttcaagaaagcttatgaactatcaact 111
Query: 112 ctttgtgatgctgag 126
|||||||||||||||
Sbjct: 112 ctttgtgatgctgag 126