Jatropha Genome Database
- JcCB0289141.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0289141.10 + phase: 2 /partial
(592 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
28962.m000437 Aquaporin PIP2.7, putative 90 2e-17
27516.m000174 Aquaporin PIP2.1, putative 88 7e-17
28962.m000436 conserved hypothetical protein 84 1e-15
29869.m001194 Aquaporin PIP2.7, putative 72 4e-12
28076.m000411 Aquaporin PIP2.1, putative 66 3e-10
29669.m000808 Aquaporin PIP1.3, putative 66 3e-10
29969.m000266 Aquaporin PIP1.1, putative 60 2e-08
30078.m002337 Aquaporin PIP2.2, putative 56 2e-07
>28962.m000437 Aquaporin PIP2.7, putative
Length = 597
Score = 89.7 bits (45), Expect = 2e-17
Identities = 81/93 (87%)
Strand = Plus / Plus
Query: 259 gattttcattcttgtctattgcaccgctgggatttctggaggtcatattaatcctgcggt 318
||||||| |||||||||||||||| ||||||||||||||||| || || || || || ||
Sbjct: 3 gattttcgttcttgtctattgcactgctgggatttctggagggcacatcaacccagcagt 62
Query: 319 gacgttcgggctgttgctggcaaggaaggtgtc 351
||| ||||||||| || |||| |||||||||||
Sbjct: 63 gacattcgggctgctggtggcgaggaaggtgtc 95
Score = 63.9 bits (32), Expect = 1e-09
Identities = 50/56 (89%)
Strand = Plus / Plus
Query: 536 tacaccgtcttgtccgccactgaccctaaacggaaagcccgtgactcccatgttcc 591
||||| ||||| ||||||||||| ||||| || |||||||| ||||||||||||||
Sbjct: 286 tacacagtcttttccgccactgatcctaagcgaaaagcccgcgactcccatgttcc 341
>27516.m000174 Aquaporin PIP2.1, putative
Length = 852
Score = 87.7 bits (44), Expect = 7e-17
Identities = 107/128 (83%)
Strand = Plus / Plus
Query: 212 tgtggcggcgttggtcttcttggcgttgcttggtcttttggtagcacgattttcattctt 271
||||| || |||||| ||||||| |||||||| |||||||| ||| ||| |||||||||
Sbjct: 211 tgtgggggtgttggtattcttggtattgcttgggcttttggtggcatgatcttcattctt 270
Query: 272 gtctattgcaccgctgggatttctggaggtcatattaatcctgcggtgacgttcgggctg 331
|| || ||||| ||||| ||||||||||| || ||||| || || ||||| ||||||||
Sbjct: 271 gtttactgcactgctggtatttctggaggacacattaacccagcagtgacattcgggcta 330
Query: 332 ttgctggc 339
|| |||||
Sbjct: 331 ttcctggc 338
>28962.m000436 conserved hypothetical protein
Length = 162
Score = 83.8 bits (42), Expect = 1e-15
Identities = 63/70 (90%)
Strand = Plus / Plus
Query: 228 ttcttggcgttgcttggtcttttggtagcacgattttcattcttgtctattgcaccgctg 287
|||||||| |||||||| |||||||| ||| ||| |||||||||| ||||||||| ||||
Sbjct: 86 ttcttggcattgcttgggcttttggtggcatgatcttcattcttgactattgcactgctg 145
Query: 288 ggatttctgg 297
||||||||||
Sbjct: 146 ggatttctgg 155
>29869.m001194 Aquaporin PIP2.7, putative
Length = 843
Score = 71.9 bits (36), Expect = 4e-12
Identities = 87/104 (83%)
Strand = Plus / Plus
Query: 248 tttggtagcacgattttcattcttgtctattgcaccgctgggatttctggaggtcatatt 307
|||||| ||| ||| || || |||||||| ||||| ||||| || ||||| |||||||||
Sbjct: 238 tttggtggcatgatctttatccttgtctactgcactgctggtatctctggtggtcatatt 297
Query: 308 aatcctgcggtgacgttcgggctgttgctggcaaggaaggtgtc 351
|||||||| || || || |||||||| |||| |||||||||||
Sbjct: 298 aatcctgctgttacttttgggctgttcttggccaggaaggtgtc 341
>28076.m000411 Aquaporin PIP2.1, putative
Length = 864
Score = 65.9 bits (33), Expect = 3e-10
Identities = 75/89 (84%)
Strand = Plus / Plus
Query: 212 tgtggcggcgttggtcttcttggcgttgcttggtcttttggtagcacgattttcattctt 271
||||| || |||||| ||||||| |||||||| |||||||| ||| ||| || ||||||
Sbjct: 229 tgtggtggtgttggtattcttggtattgcttgggcttttggtggcatgatctttattctt 288
Query: 272 gtctattgcaccgctgggatttctggagg 300
|| || ||||| ||||| |||||||||||
Sbjct: 289 gtttactgcactgctggtatttctggagg 317
>29669.m000808 Aquaporin PIP1.3, putative
Length = 864
Score = 65.9 bits (33), Expect = 3e-10
Identities = 63/73 (86%)
Strand = Plus / Plus
Query: 284 gctgggatttctggaggtcatattaatcctgcggtgacgttcgggctgttgctggcaagg 343
||||| ||||| ||||| || || || || |||||||| ||||||||||| |||||||||
Sbjct: 322 gctggcatttcaggaggacacataaacccagcggtgaccttcgggctgtttctggcaagg 381
Query: 344 aaggtgtcgttga 356
||| |||||||||
Sbjct: 382 aagttgtcgttga 394
>29969.m000266 Aquaporin PIP1.1, putative
Length = 867
Score = 60.0 bits (30), Expect = 2e-08
Identities = 63/74 (85%)
Strand = Plus / Plus
Query: 272 gtctattgcaccgctgggatttctggaggtcatattaatcctgcggtgacgttcgggctg 331
||||| ||||| ||||| ||||| || ||||||||||| || || ||||| |||||||||
Sbjct: 310 gtctactgcactgctggcatttcagggggtcatattaacccagcagtgacattcgggctg 369
Query: 332 ttgctggcaaggaa 345
|| ||||||||||
Sbjct: 370 tttttggcaaggaa 383
>30078.m002337 Aquaporin PIP2.2, putative
Length = 867
Score = 56.0 bits (28), Expect = 2e-07
Identities = 112/140 (80%)
Strand = Plus / Plus
Query: 212 tgtggcggcgttggtcttcttggcgttgcttggtcttttggtagcacgattttcattctt 271
||||| || |||||| |||||||| | |||||| | || ||| ||| ||||||||||||
Sbjct: 226 tgtggtggagttggtattcttggcatcgcttgggccttcggtggcatgattttcattctc 285
Query: 272 gtctattgcaccgctgggatttctggaggtcatattaatcctgcggtgacgttcgggctg 331
|| || ||||| || || ||||| || || || || ||||| || ||||| || ||||||
Sbjct: 286 gtttactgcactgccggtatttcaggtggacacatcaatcccgctgtgacttttgggctg 345
Query: 332 ttgctggcaaggaaggtgtc 351
|| ||||||| ||||||||
Sbjct: 346 tttttggcaagaaaggtgtc 365