Jatropha Genome Database

JcCB0289141.10
Show Alignment: 
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0289141.10 + phase: 2 /partial
         (592 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

28962.m000437 Aquaporin PIP2.7, putative                               90   2e-17
27516.m000174 Aquaporin PIP2.1, putative                               88   7e-17
28962.m000436 conserved hypothetical protein                           84   1e-15
29869.m001194 Aquaporin PIP2.7, putative                               72   4e-12
28076.m000411 Aquaporin PIP2.1, putative                               66   3e-10
29669.m000808 Aquaporin PIP1.3, putative                               66   3e-10
29969.m000266 Aquaporin PIP1.1, putative                               60   2e-08
30078.m002337 Aquaporin PIP2.2, putative                               56   2e-07

>28962.m000437 Aquaporin PIP2.7, putative
          Length = 597

 Score = 89.7 bits (45), Expect = 2e-17
 Identities = 81/93 (87%)
 Strand = Plus / Plus

                                                                       
Query: 259 gattttcattcttgtctattgcaccgctgggatttctggaggtcatattaatcctgcggt 318
           ||||||| |||||||||||||||| ||||||||||||||||| || || || || || ||
Sbjct: 3   gattttcgttcttgtctattgcactgctgggatttctggagggcacatcaacccagcagt 62

                                            
Query: 319 gacgttcgggctgttgctggcaaggaaggtgtc 351
           ||| ||||||||| || |||| |||||||||||
Sbjct: 63  gacattcgggctgctggtggcgaggaaggtgtc 95



 Score = 63.9 bits (32), Expect = 1e-09
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 536 tacaccgtcttgtccgccactgaccctaaacggaaagcccgtgactcccatgttcc 591
           ||||| ||||| ||||||||||| ||||| || |||||||| ||||||||||||||
Sbjct: 286 tacacagtcttttccgccactgatcctaagcgaaaagcccgcgactcccatgttcc 341


>27516.m000174 Aquaporin PIP2.1, putative
          Length = 852

 Score = 87.7 bits (44), Expect = 7e-17
 Identities = 107/128 (83%)
 Strand = Plus / Plus

                                                                       
Query: 212 tgtggcggcgttggtcttcttggcgttgcttggtcttttggtagcacgattttcattctt 271
           ||||| || |||||| |||||||  |||||||| |||||||| ||| ||| |||||||||
Sbjct: 211 tgtgggggtgttggtattcttggtattgcttgggcttttggtggcatgatcttcattctt 270

                                                                       
Query: 272 gtctattgcaccgctgggatttctggaggtcatattaatcctgcggtgacgttcgggctg 331
           || || ||||| ||||| ||||||||||| || ||||| || || ||||| |||||||| 
Sbjct: 271 gtttactgcactgctggtatttctggaggacacattaacccagcagtgacattcgggcta 330

                   
Query: 332 ttgctggc 339
           || |||||
Sbjct: 331 ttcctggc 338


>28962.m000436 conserved hypothetical protein
          Length = 162

 Score = 83.8 bits (42), Expect = 1e-15
 Identities = 63/70 (90%)
 Strand = Plus / Plus

                                                                       
Query: 228 ttcttggcgttgcttggtcttttggtagcacgattttcattcttgtctattgcaccgctg 287
           |||||||| |||||||| |||||||| ||| ||| |||||||||| ||||||||| ||||
Sbjct: 86  ttcttggcattgcttgggcttttggtggcatgatcttcattcttgactattgcactgctg 145

                     
Query: 288 ggatttctgg 297
           ||||||||||
Sbjct: 146 ggatttctgg 155


>29869.m001194 Aquaporin PIP2.7, putative
          Length = 843

 Score = 71.9 bits (36), Expect = 4e-12
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 248 tttggtagcacgattttcattcttgtctattgcaccgctgggatttctggaggtcatatt 307
           |||||| ||| ||| || || |||||||| ||||| ||||| || ||||| |||||||||
Sbjct: 238 tttggtggcatgatctttatccttgtctactgcactgctggtatctctggtggtcatatt 297

                                                       
Query: 308 aatcctgcggtgacgttcgggctgttgctggcaaggaaggtgtc 351
           |||||||| || || || ||||||||  |||| |||||||||||
Sbjct: 298 aatcctgctgttacttttgggctgttcttggccaggaaggtgtc 341


>28076.m000411 Aquaporin PIP2.1, putative
          Length = 864

 Score = 65.9 bits (33), Expect = 3e-10
 Identities = 75/89 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 tgtggcggcgttggtcttcttggcgttgcttggtcttttggtagcacgattttcattctt 271
           ||||| || |||||| |||||||  |||||||| |||||||| ||| ||| || ||||||
Sbjct: 229 tgtggtggtgttggtattcttggtattgcttgggcttttggtggcatgatctttattctt 288

                                        
Query: 272 gtctattgcaccgctgggatttctggagg 300
           || || ||||| ||||| |||||||||||
Sbjct: 289 gtttactgcactgctggtatttctggagg 317


>29669.m000808 Aquaporin PIP1.3, putative
          Length = 864

 Score = 65.9 bits (33), Expect = 3e-10
 Identities = 63/73 (86%)
 Strand = Plus / Plus

                                                                       
Query: 284 gctgggatttctggaggtcatattaatcctgcggtgacgttcgggctgttgctggcaagg 343
           ||||| ||||| ||||| || || || || |||||||| ||||||||||| |||||||||
Sbjct: 322 gctggcatttcaggaggacacataaacccagcggtgaccttcgggctgtttctggcaagg 381

                        
Query: 344 aaggtgtcgttga 356
           ||| |||||||||
Sbjct: 382 aagttgtcgttga 394


>29969.m000266 Aquaporin PIP1.1, putative
          Length = 867

 Score = 60.0 bits (30), Expect = 2e-08
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 272 gtctattgcaccgctgggatttctggaggtcatattaatcctgcggtgacgttcgggctg 331
           ||||| ||||| ||||| ||||| || ||||||||||| || || ||||| |||||||||
Sbjct: 310 gtctactgcactgctggcatttcagggggtcatattaacccagcagtgacattcgggctg 369

                         
Query: 332 ttgctggcaaggaa 345
           ||  ||||||||||
Sbjct: 370 tttttggcaaggaa 383


>30078.m002337 Aquaporin PIP2.2, putative
          Length = 867

 Score = 56.0 bits (28), Expect = 2e-07
 Identities = 112/140 (80%)
 Strand = Plus / Plus

                                                                       
Query: 212 tgtggcggcgttggtcttcttggcgttgcttggtcttttggtagcacgattttcattctt 271
           ||||| || |||||| |||||||| | |||||| | || ||| ||| |||||||||||| 
Sbjct: 226 tgtggtggagttggtattcttggcatcgcttgggccttcggtggcatgattttcattctc 285

                                                                       
Query: 272 gtctattgcaccgctgggatttctggaggtcatattaatcctgcggtgacgttcgggctg 331
           || || ||||| || || ||||| || || || || ||||| || ||||| || ||||||
Sbjct: 286 gtttactgcactgccggtatttcaggtggacacatcaatcccgctgtgacttttgggctg 345

                               
Query: 332 ttgctggcaaggaaggtgtc 351
           ||  ||||||| ||||||||
Sbjct: 346 tttttggcaagaaaggtgtc 365