Jatropha Genome Database

JcCB0287851.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0287851.10 + phase: 2 /pseudo/partial
         (461 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30147.m014493 ccaat-binding transcription factor, putative            170   5e-42
29844.m003332 ccaat-binding transcription factor, putative             54   8e-07

>30147.m014493 ccaat-binding transcription factor, putative
          Length = 810

 Score =  170 bits (86), Expect = 5e-42
 Identities = 215/255 (84%), Gaps = 6/255 (2%)
 Strand = Plus / Plus

                                                                       
Query: 126 aaagaatgacatcgctgcagccattactagaactgatatatttgattttttggtggatat 185
           |||||||||||||||||| || || || |||||||||||||||||||| ||||| |||||
Sbjct: 357 aaagaatgacatcgctgctgctataacaagaactgatatatttgatttcttggttgatat 416

                                                                       
Query: 186 tgtgcctagagatgagatcaaggatgaggc--cgggctt-ggaggaatggttggggccac 242
           ||||||||||||||||||||| ||||||||  | || || ||||| ||  ||||||||||
Sbjct: 417 tgtgcctagagatgagatcaaagatgaggctgctggtttaggagggattattggggccac 476

                                                                       
Query: 243 agccagtggtgtgccttattattatcctccgatggggcagcccactggtgccggccctgg 302
            || |||||||| |||||||||||||| || ||||| ||||| |||  | | || |||||
Sbjct: 477 tgctagtggtgttccttattattatccaccaatgggtcagcctactactcctggtcctgg 536

                                                                       
Query: 303 cggaatgatgattggaaggcccgccg---tggatcccactggagtttatgttcagccacc 359
            || ||||||||||| ||||| || |   ||||||| || || |||||||| ||||||||
Sbjct: 537 agggatgatgattggtaggcctgctgctatggatcctacgggtgtttatgtgcagccacc 596

                          
Query: 360 ttcacaggcttggca 374
           ||| |||||||||||
Sbjct: 597 ttctcaggcttggca 611


>29844.m003332 ccaat-binding transcription factor, putative
          Length = 741

 Score = 54.0 bits (27), Expect = 8e-07
 Identities = 54/63 (85%)
 Strand = Plus / Plus

                                                                       
Query: 126 aaagaatgacatcgctgcagccattactagaactgatatatttgattttttggtggatat 185
           |||||||||||| ||||| || ||||| || |||||||| ||||| ||| |||| |||||
Sbjct: 441 aaagaatgacattgctgcggcaattacaaggactgatatttttgactttctggttgatat 500

              
Query: 186 tgt 188
           |||
Sbjct: 501 tgt 503