Jatropha Genome Database

JcCB0287791.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0287791.10 + phase: 0 /pseudo/partial
         (930 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30054.m000829 conserved hypothetical protein                           76   4e-13

>30054.m000829 conserved hypothetical protein
          Length = 2262

 Score = 75.8 bits (38), Expect = 4e-13
 Identities = 80/94 (85%)
 Strand = Plus / Plus

                                                                        
Query: 8    gcaattgtggtgcataatggatttttacccacttctgggcattacttctcatatgtacgg 67
            ||||| ||||||||||||||||| | ||||||||||||||||||||| |  | ||| || 
Sbjct: 1312 gcaatcgtggtgcataatggattgtcacccacttctgggcattacttttgttttgttcga 1371

                                              
Query: 68   tcctctcctgacacatggcacaagttggatgact 101
            ||||||||   ||||||||| ||| |||||||||
Sbjct: 1372 tcctctccaagcacatggcataagctggatgact 1405



 Score = 60.0 bits (30), Expect = 2e-08
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                  
Query: 810  acttatggctgctatgcttccacgaaatgacaagaaaagaagattaagatcatc 863
            |||||| | |||||| ||||| | ||||||||||||||||||| ||||||||||
Sbjct: 2133 acttattgatgctatacttccccaaaatgacaagaaaagaagactaagatcatc 2186