Jatropha Genome Database

JcCB0286011.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0286011.20 + phase: 0 
         (992 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29726.m003975 conserved hypothetical protein                          100   3e-20
29726.m003974 hypothetical protein                                     54   2e-06

>29726.m003975 conserved hypothetical protein
          Length = 186

 Score = 99.6 bits (50), Expect = 3e-20
 Identities = 113/134 (84%)
 Strand = Plus / Plus

                                                                       
Query: 233 ctgatgaggccacaattaagaagcagtacaggaagtttgctctcttacttcaccctgaca 292
           |||||||||| || || |||||||| || | || |  ||||||  ||||||| |||||||
Sbjct: 50  ctgatgaggcaaccatcaagaagcaatataagatggctgctcttctacttcatcctgaca 109

                                                                       
Query: 293 aaaataagttccccggcgcagaggctgctttcaagttgattggtgaagctcaaagggtgc 352
           ||||||||||| | || |||||||||||||| ||||| ||||||||||| ||||||||||
Sbjct: 110 aaaataagttctctggtgcagaggctgcttttaagtttattggtgaagcccaaagggtgc 169

                         
Query: 353 tatcagacaaagga 366
           | | ||| ||||||
Sbjct: 170 ttttagaaaaagga 183


>29726.m003974 hypothetical protein
          Length = 792

 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                              
Query: 783 caattcaagttctgagcaatctaaaaccgagtcctttcaaaagaaaggttg 833
           |||||||||| | ||||| |||||||| || | ||||||||||||||||||
Sbjct: 171 caattcaagtgccgagcattctaaaacggatttctttcaaaagaaaggttg 221