Jatropha Genome Database

JcCB0285631.10
Show Alignment: 
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0285631.10 - phase: 0 
         (249 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29999.m000206 arginine biosynthesis protein argJ 1, putative           58   3e-08

>29999.m000206 arginine biosynthesis protein argJ 1, putative
          Length = 1410

 Score = 58.0 bits (29), Expect = 3e-08
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 134 ccaattatatccctgcagctcccatttttatcccagaagggccatggaa 182
           ||||||||||||| || ||||||||||| ||||||||||| || |||||
Sbjct: 134 ccaattatatcccagctgctcccattttgatcccagaaggcccttggaa 182