Jatropha Genome Database
- JcCB0285631.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0285631.10 - phase: 0
(249 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
29999.m000206 arginine biosynthesis protein argJ 1, putative 58 3e-08
>29999.m000206 arginine biosynthesis protein argJ 1, putative
Length = 1410
Score = 58.0 bits (29), Expect = 3e-08
Identities = 44/49 (89%)
Strand = Plus / Plus
Query: 134 ccaattatatccctgcagctcccatttttatcccagaagggccatggaa 182
||||||||||||| || ||||||||||| ||||||||||| || |||||
Sbjct: 134 ccaattatatcccagctgctcccattttgatcccagaaggcccttggaa 182