Jatropha Genome Database

JcCB0284451.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0284451.10 + phase: 2 /pseudo/partial
         (449 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29932.m000608 cationic amino acid transporter, putative               100   1e-20
29932.m000609 cationic amino acid transporter, putative                62   3e-09

>29932.m000608 cationic amino acid transporter, putative
          Length = 1764

 Score = 99.6 bits (50), Expect = 1e-20
 Identities = 145/173 (83%), Gaps = 4/173 (2%)
 Strand = Plus / Plus

                                                                        
Query: 102  gatggatggattggctatgttattactatacccatatggttattggctacactagtacta 161
            ||||| |||||||| ||||  |||||  |||| |||||||| || || ||||||| | | 
Sbjct: 1444 gatggctggattgggtatgcgattacagtaccaatatggttcttcgcaacactaggaatc 1503

                                                                        
Query: 162  agtgtttttgttccaaaagcaagagctccaaaattatggggtgttccattagtgccatgt 221
            ||||||||||||||| | ||||||||||||||| ||||||| |||||| |||||||||| 
Sbjct: 1504 agtgtttttgttccacaggcaagagctccaaaactatggggggttccactagtgccatg- 1562

                                                                 
Query: 222  ggataccacctgcttcgattattc-tcaacattttccttcttggatcgattga 273
             | | ||| ||||||| | ||||| ||||||| |||||||||||||| |||||
Sbjct: 1563 -gttgccatctgcttc-agtattcatcaacatattccttcttggatctattga 1613


>29932.m000609 cationic amino acid transporter, putative
          Length = 1389

 Score = 61.9 bits (31), Expect = 3e-09
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                        
Query: 54   attcttggctcttctattgcaactgctgctatatggggtgcaggtggagatggatggatt 113
            |||||||| |||||  |||| ||||||| ||| |||| ||||||||||||||| ||||||
Sbjct: 943  attcttgggtcttcagttgctactgctgttatctgggctgcaggtggagatggttggatt 1002

                                               
Query: 114  ggctatgttattactatacccatatggttattggc 148
            || || || || ||  ||||||| ||||| |||||
Sbjct: 1003 gggtacgtgatcacagtacccatttggttcttggc 1037