Jatropha Genome Database

JcCB0283351.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0283351.10 + phase: 1 /pseudo/partial/short
         (151 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29942.m000747 adenosine diphosphatase, putative                        66   6e-11

>29942.m000747 adenosine diphosphatase, putative
          Length = 1443

 Score = 65.9 bits (33), Expect = 6e-11
 Identities = 78/93 (83%)
 Strand = Plus / Plus

                                                                       
Query: 5   agaaaagggtgtttacacgtgggttgctgtaaattatgctcttggaaccttgggaggtga 64
           |||||||||||| ||  | ||||||||  |||| |||||| |||| ||| ||||||||||
Sbjct: 615 agaaaagggtgtctatgcttgggttgcaataaactatgcttttgggaccctgggaggtga 674

                                            
Query: 65  tcctcgggaaaccactgggatagttgaacttgg 97
           | |||   ||||||| |||||||||||||||||
Sbjct: 675 tgctcaaaaaaccacagggatagttgaacttgg 707