Jatropha Genome Database

JcCB0273441.10
Show Alignment: 
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0273441.10 + phase: 0 
         (639 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29801.m003084 conserved hypothetical protein                          283   6e-76
29801.m003083 conserved hypothetical protein                          281   2e-75

>29801.m003084 conserved hypothetical protein
          Length = 633

 Score =  283 bits (143), Expect = 6e-76
 Identities = 364/437 (83%), Gaps = 3/437 (0%)
 Strand = Plus / Plus

                                                                       
Query: 190 atcagcttgatcattgaagacatggaaggagttgcatatacagatgacaatgaaattcat 249
           |||||||||||||||||||| || || || |||||||| ||||| || ||||| || |||
Sbjct: 184 atcagcttgatcattgaagatatagatggggttgcatacacagaagataatgagatgcat 243

                                                                       
Query: 250 tttagcacaaaatatgtagcaaattattccgaggact---tgaaaagtgaagttatcgga 306
            |||| |||| |||| ||| ||||| |||   ||| |   ||| |||||||||||  |||
Sbjct: 244 attagtacaagatatatagaaaattgttcaagggaatgtttgagaagtgaagttactgga 303

                                                                       
Query: 307 attctttaccatgagatgacacacatatggcaatggaatggtaatggaaaaactccagga 366
           || || || ||||| | |||||| |||||||||||||| || |||||  |||||||||||
Sbjct: 304 atcctctatcatgaaacgacacatatatggcaatggaacggaaatgggcaaactccagga 363

                                                                       
Query: 367 ggattaattgaagggatagctgatcttgtaaggttaaaggctaattatgcacctagtcac 426
           ||| |||||||||| || |||||| ||||||||||||||||||| ||||| |||||||||
Sbjct: 364 ggactaattgaaggaattgctgattttgtaaggttaaaggctaactatgcgcctagtcac 423

                                                                       
Query: 427 tgggtgcagccagggcagggcgagaggtgggatcaagggtatgatgttacggctaggttt 486
           ||||| |||||||| || || || ||||||||||||||||| |||||||| || || |||
Sbjct: 424 tgggttcagccaggacaaggtgataggtgggatcaagggtacgatgttacagcaagattt 483

                                                                       
Query: 487 ttggattactgtaatgatcttagagatggttttgtggctgaccttaacaagaaaatgagg 546
           |||||||||||||||||||||||| |||| ||||| ||||| || |||||||| ||||  
Sbjct: 484 ttggattactgtaatgatcttagaaatgggtttgtagctgagctgaacaagaagatgata 543

                                                                       
Query: 547 agtgattataaggttgagtactttgttgagctactagggaagcctgttcatcagctttgg 606
             ||||||||  | ||||| |||  ||||  | ||||||||| ||||| |||||||||||
Sbjct: 544 gatgattatagtgatgagttcttcattgaattgctagggaagtctgttgatcagctttgg 603

                            
Query: 607 aatgaatacaaggccaa 623
           | ||| |||||||||||
Sbjct: 604 agtgattacaaggccaa 620


>29801.m003083 conserved hypothetical protein
          Length = 678

 Score =  281 bits (142), Expect = 2e-75
 Identities = 211/234 (90%)
 Strand = Plus / Plus

                                                                       
Query: 311 tttaccatgagatgacacacatatggcaatggaatggtaatggaaaaactccaggaggat 370
           |||||||||| |||||||| || |||||||||||||| |||||  || ||||||||||| 
Sbjct: 353 tttaccatgaaatgacacatatttggcaatggaatggcaatggccaagctccaggaggac 412

                                                                       
Query: 371 taattgaagggatagctgatcttgtaaggttaaaggctaattatgcacctagtcactggg 430
           | |||||||| || |||||| ||||||||||||||||||| |||||||||||||||||||
Sbjct: 413 tgattgaaggaattgctgattttgtaaggttaaaggctaactatgcacctagtcactggg 472

                                                                       
Query: 431 tgcagccagggcagggcgagaggtgggatcaagggtatgatgttacggctaggtttttgg 490
           | |||||||| || || || |||||||||||||||||||||||||| || ||||||||||
Sbjct: 473 ttcagccaggacaaggtgataggtgggatcaagggtatgatgttacagcaaggtttttgg 532

                                                                 
Query: 491 attactgtaatgatcttagagatggttttgtggctgaccttaacaagaaaatga 544
           |||||||||||||||||||| |||||||||||||||| ||||||||||| ||||
Sbjct: 533 attactgtaatgatcttagaaatggttttgtggctgagcttaacaagaagatga 586