Jatropha Genome Database

JcCB0272031.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0272031.20 - phase: 0 /pseudo/partial
         (210 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30128.m008567 fk506-binding protein, putative                         170   2e-42

>30128.m008567 fk506-binding protein, putative
          Length = 741

 Score =  170 bits (86), Expect = 2e-42
 Identities = 143/162 (88%)
 Strand = Plus / Plus

                                                                       
Query: 40  aggatagttgttcctccagaattgggatatccagagaatgacttcaataagagtggccca 99
           |||||| ||||||| |||||| |||||||||| |||||||| ||||||| ||||||||||
Sbjct: 568 aggataattgttcccccagaactgggatatcctgagaatgatttcaataggagtggccca 627

                                                                       
Query: 100 agacctactacattttcggggcaaagagccttggattttgtgctgaggaatcaggggctc 159
           || || || || ||||| || ||||||||||||||||||||||||||||| |||||||| 
Sbjct: 628 aggccgacaaccttttcaggtcaaagagccttggattttgtgctgaggaaccaggggctg 687

                                                     
Query: 160 atagacaaaactcttctctttgatattgagctcctaaaaatc 201
           |||||||||||||| || |||||||| ||||| || ||||||
Sbjct: 688 atagacaaaactctgctgtttgatatagagctgctcaaaatc 729