Jatropha Genome Database

JcCB0270961.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0270961.10 - phase: 0 
         (273 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30170.m013776 mads box protein, putative                               66   1e-10
30147.m014483 MADS-box transcription factor, putative                  62   2e-09

>30170.m013776 mads box protein, putative
          Length = 693

 Score = 65.9 bits (33), Expect = 1e-10
 Identities = 81/97 (83%)
 Strand = Plus / Plus

                                                                       
Query: 25  aagagaatagagaacccaacaaacagacaggtaaccttctccaagagaagaaatggcctt 84
           |||||||| |||||  |||||||||| || || |||||||| || || |||||||| |||
Sbjct: 25  aagagaattgagaatacaacaaacaggcaagtcaccttctctaaaaggagaaatgggctt 84

                                                
Query: 85  ctcaagaaagctttcgagctttctattctttgtgatg 121
            ||||||||||||  || |||||| |||| |||||||
Sbjct: 85  atcaagaaagcttatgaactttctgttctctgtgatg 121


>30147.m014483 MADS-box transcription factor, putative
          Length = 366

 Score = 61.9 bits (31), Expect = 2e-09
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                       
Query: 184 atggataggaccattgccaggtatcggagcgaagttggattgttaggatcaaatgatcag 243
           ||||||||||||||||| |||||  |||||||||| ||| | |||||||||| ||| | |
Sbjct: 1   atggataggaccattgctaggtacaggagcgaagtaggacttttaggatcaactgacctg 60

                      
Query: 244 cgttccagatc 254
           ||| |||||||
Sbjct: 61  cgtaccagatc 71