Jatropha Genome Database
- JcCB0262451.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0262451.10 - phase: 0 /pseudo
(271 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
27647.m000176 aspartate semialdehyde dehydrogenase, putative 188 1e-47
27647.m000178 aspartate semialdehyde dehydrogenase, putative 101 2e-21
>27647.m000176 aspartate semialdehyde dehydrogenase, putative
Length = 669
Score = 188 bits (95), Expect = 1e-47
Identities = 170/195 (87%)
Strand = Plus / Plus
Query: 17 aaattacagtgacccagatgagaaaatcagttgaaaagcttggttctgcaactgagagct 76
||||| |||||||||||||||| ||||| |||||||||||||||||| ||||||||| |
Sbjct: 17 aaattgcagtgacccagatgaggaaatcggttgaaaagcttggttcttcaactgagaatt 76
Query: 77 gtagtgatacaacattgatgagattcttgattgcaaggtcaatggacccagaaaaggcag 136
|||||| |||| | || |||||||||||||||||||||||||||||||| |||||||
Sbjct: 77 atagtgacgcaacgattatcagattcttgattgcaaggtcaatggacccagagaaggcag 136
Query: 137 caaagatgtttgtgcagtggcagaaatggaggtctgcttttgttcccaatgggtttatac 196
||||||||||||| |||||||||||||||||| || |||||||| ||||| | |||
Sbjct: 137 caaagatgtttgtacagtggcagaaatggaggagcgcgtttgttcctaatggctctatct 196
Query: 197 cagactctgacgtcc 211
|||||||||| ||||
Sbjct: 197 cagactctgaagtcc 211
Score = 65.9 bits (33), Expect = 1e-10
Identities = 36/37 (97%)
Strand = Plus / Plus
Query: 235 agttcgtggttcatttcctagacaaaacaattgcaag 271
|||||||||||||||| ||||||||||||||||||||
Sbjct: 329 agttcgtggttcatttgctagacaaaacaattgcaag 365
>27647.m000178 aspartate semialdehyde dehydrogenase, putative
Length = 732
Score = 101 bits (51), Expect = 2e-21
Identities = 75/83 (90%)
Strand = Plus / Plus
Query: 86 caacattgatgagattcttgattgcaaggtcaatggacccagaaaaggcagcaaagatgt 145
|||| |||||||||||||||||||| || |||||||| ||||||||||||||||||||||
Sbjct: 86 caactttgatgagattcttgattgcgagatcaatggatccagaaaaggcagcaaagatgt 145
Query: 146 ttgtgcagtggcagaaatggagg 168
| || || ||||| |||||||||
Sbjct: 146 tcgttcaatggcaaaaatggagg 168