Jatropha Genome Database

JcCB0256761.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0256761.10 - phase: 0 /partial
         (300 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

28320.m001106 hypothetical protein                                    135   2e-31

>28320.m001106 hypothetical protein
          Length = 1224

 Score =  135 bits (68), Expect = 2e-31
 Identities = 131/152 (86%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggacgggaagatagaaatctccattgacaagcttcctgtcaagcgcttggaagccatc 60
           ||||| |||||  ||||||||||  | ||||||||||| || ||||| ||||| ||||||
Sbjct: 1   atggaggggaaagtagaaatctctctcgacaagcttcccgttaagcgattggaggccatc 60

                                                                       
Query: 61  gatgagaacggtgccgaacgcttccctactgatgttggatatgacgagaagagagtatca 120
           || || || || | |||||| ||||| ||||||||||||||||| ||||| |||||||||
Sbjct: 61  gaagaaaatggcgtcgaacgattcccgactgatgttggatatgatgagaaaagagtatca 120

                                           
Query: 121 ttgattcggcgaatagattttgcatgggcagt 152
           |||||||||||||||||||| | |||||||||
Sbjct: 121 ttgattcggcgaatagatttcggatgggcagt 152



 Score = 97.6 bits (49), Expect = 4e-20
 Identities = 73/81 (90%)
 Strand = Plus / Plus

                                                                       
Query: 220 ccatggccatggcagagcatggtggagaacttgcagttagctcatcaggagctctctatt 279
           ||||||||||||||||| ||||||||||| ||||| || ||||| |||||||||||| | 
Sbjct: 232 ccatggccatggcagagtatggtggagaatttgcaattggctcaccaggagctctctgtc 291

                                
Query: 280 attatcgatctcatcaatact 300
           ||||| |||||||||||||||
Sbjct: 292 attattgatctcatcaatact 312