Jatropha Genome Database

JcCB0254931.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0254931.10 - phase: 0 
         (234 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

28320.m001111 conserved hypothetical protein                          248   1e-65
29848.m004648 conserved hypothetical protein                          105   1e-22

>28320.m001111 conserved hypothetical protein
          Length = 393

 Score =  248 bits (125), Expect = 1e-65
 Identities = 200/225 (88%)
 Strand = Plus / Plus

                                                                       
Query: 10  gctatagccactgttgtcactgttgcagaaatcctgaaaaacaatggattggctattgaa 69
           ||||| || |||||||| |||||||| ||||| ||||| |||||||||||||||||||||
Sbjct: 169 gctattgctactgttgtgactgttgctgaaattctgaagaacaatggattggctattgaa 228

                                                                       
Query: 70  aagaagatcatgacttcaacagttgatatgagagatgaagcaagagggcggcctgtacag 129
           | ||| ||||||||||| || |||||||||| ||||||| ||||||| |||||||| |||
Sbjct: 229 aggaaaatcatgacttccactgttgatatgaaagatgaatcaagaggacggcctgtccag 288

                                                                       
Query: 130 aaagctaagattgagatattgctcgggaaaactgaaaatttcgatgaattgatggctgct 189
           |||||||||||||||||| |||| ||||| |||||||| || |||||||||||||| |||
Sbjct: 289 aaagctaagattgagatactgctggggaagactgaaaactttgatgaattgatggcagct 348

                                                        
Query: 190 gctgctgaagagagggaaatggcagatgctgaagagcagagttga 234
           |||||||||||||| || || | ||||| ||||||||||||||||
Sbjct: 349 gctgctgaagagagagatattgtagatggtgaagagcagagttga 393


>29848.m004648 conserved hypothetical protein
          Length = 387

 Score =  105 bits (53), Expect = 1e-22
 Identities = 119/141 (84%)
 Strand = Plus / Plus

                                                                       
Query: 52  aatggattggctattgaaaagaagatcatgacttcaacagttgatatgagagatgaagca 111
           ||||| ||||||||||||||||||||||||||||| || ||||| ||||| || ||  ||
Sbjct: 211 aatgggttggctattgaaaagaagatcatgacttcgactgttgacatgagggaggataca 270

                                                                       
Query: 112 agagggcggcctgtacagaaagctaagattgagatattgctcgggaaaactgaaaatttc 171
            |||| || || || |  ||||||||||||||||||||||| ||||| || || || || 
Sbjct: 271 ggaggacgccccgtccctaaagctaagattgagatattgctagggaagacggagaagttt 330

                                
Query: 172 gatgaattgatggctgctgct 192
           ||||| |||||||||||||||
Sbjct: 331 gatgagttgatggctgctgct 351