Jatropha Genome Database

JcCB0250351.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0250351.10 + phase: 0 
         (381 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30076.m004535 hypothetical protein                                     66   2e-10

>30076.m004535 hypothetical protein
          Length = 363

 Score = 65.9 bits (33), Expect = 2e-10
 Identities = 36/37 (97%)
 Strand = Plus / Plus

                                                
Query: 182 ataaaatacctgatgtgatgacgtgtcctccagctcc 218
           |||||||||||||||| ||||||||||||||||||||
Sbjct: 179 ataaaatacctgatgtcatgacgtgtcctccagctcc 215