Jatropha Genome Database
- JcCB0250351.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0250351.10 + phase: 0
(381 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
30076.m004535 hypothetical protein 66 2e-10
>30076.m004535 hypothetical protein
Length = 363
Score = 65.9 bits (33), Expect = 2e-10
Identities = 36/37 (97%)
Strand = Plus / Plus
Query: 182 ataaaatacctgatgtgatgacgtgtcctccagctcc 218
|||||||||||||||| ||||||||||||||||||||
Sbjct: 179 ataaaatacctgatgtcatgacgtgtcctccagctcc 215