Jatropha Genome Database

JcCB0246261.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0246261.10 - phase: 0 /pseudo/partial
         (210 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29776.m000488 isoamylase, putative                                    204   1e-52

>29776.m000488 isoamylase, putative
          Length = 2388

 Score =  204 bits (103), Expect = 1e-52
 Identities = 148/163 (90%)
 Strand = Plus / Plus

                                                                        
Query: 5    tagctgaagcatgggatgcaggaggcttgtatcaagttggttgttttcctcattggcaaa 64
            ||||||||||||||||  | ||||||||||||||||||||||  ||||||||||||||||
Sbjct: 1430 tagctgaagcatgggacactggaggcttgtatcaagttggttcctttcctcattggcaaa 1489

                                                                        
Query: 65   tatggtcagaatggaatggaaagtatcgtgacattgtgaggcagtttatcaagggtacag 124
            ||||||||||||||||||| |||||||| ||  ||||||||||||| |||||||||||||
Sbjct: 1490 tatggtcagaatggaatgggaagtatcgggatgttgtgaggcagttcatcaagggtacag 1549

                                                       
Query: 125  atggtttctctggtgcttttgctgaatgcctatgtggaagccc 167
            |||| || ||||| |||||||| |||||||||||||| |||||
Sbjct: 1550 atggcttttctggggcttttgcagaatgcctatgtgggagccc 1592