Jatropha Genome Database
- JcCB0245251.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0245251.10 + phase: 0 /pseudo/partial
(1650 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
30014.m000456 ATP binding protein, putative 139 6e-32
30014.m000437 conserved hypothetical protein 137 2e-31
28229.m000056 S-locus-specific glycoprotein S6 precursor, putative 127 2e-28
30014.m000448 conserved hypothetical protein 96 8e-19
29615.m000503 serine-threonine protein kinase, plant-type, putative 86 8e-16
29842.m003712 S-locus-specific glycoprotein S6 precursor, putative 84 3e-15
29842.m003707 Negative regulator of the PHO system, putative 84 3e-15
29933.m001463 S-locus-specific glycoprotein S6 precursor, putative 78 2e-13
38590.m000013 S-locus-specific glycoprotein S13 precursor, putative 70 5e-11
29784.m000368 B-Raf proto-oncogene serine/threonine-protein kina... 70 5e-11
60621.m000011 S-locus-specific glycoprotein S13 precursor, putative 70 5e-11
28320.m001089 conserved hypothetical protein 60 4e-08
30014.m000454 S-locus-specific glycoprotein S6 precursor, putative 58 2e-07
29842.m003666 ATP binding protein, putative 54 3e-06
>30014.m000456 ATP binding protein, putative
Length = 4794
Score = 139 bits (70), Expect = 6e-32
Identities = 265/330 (80%)
Strand = Plus / Plus
Query: 802 caaggattaatcgagttcaaaaacgaagttatattgattgcaaaacttcagcaccgaaat 861
|||||||| | |||||||||||| ||||| ||||| || || | |||||||||||| |||
Sbjct: 3946 caaggattgaacgagttcaaaaatgaagtaatattaatagccagacttcagcaccgtaat 4005
Query: 862 cttgtaaagcttcttggttgctgcattcaaggaaatgaaagactgcttatatacgaatac 921
||||||||||||||||||||||||| ||| | | |||| | | || | || || ||||||
Sbjct: 4006 cttgtaaagcttcttggttgctgcactcatgaagatgagaaaatgttaatctatgaatac 4065
Query: 922 atgccaaacaaaagcctggattacttcatttttgatcaaactagaggaaaactattagat 981
||||| ||||||||| |||| | ||| ||||||||| ||| ||| | ||| || |||||
Sbjct: 4066 atgcctaacaaaagcttggacttctttatttttgataaaatgagaagcaaattactagat 4125
Query: 982 tggtccaagcgtttcaacattatgtgcgcaatagctaggggccttctctatcttcatcaa 1041
||| || || ||| |||| || | | ||| ||| | || ||||| ||||||||||||
Sbjct: 4126 tggcataaacggttccacatcattggtggaattgctcgaggtcttctttatcttcatcaa 4185
Query: 1042 gattcaagacttagaattatacacagagatctcaaagcaagtaatgtattgcttgataat 1101
|| || ||||| | ||| || ||| ||||||||||||| ||||| | || | ||||||
Sbjct: 4186 gactctagactaaaaatcattcaccgagatctcaaagccagtaacattttattggataat 4245
Query: 1102 gagatgaacccgaagatttcagattttggc 1131
|| ||||| ||||| |||||||||||||||
Sbjct: 4246 gaaatgaatccgaaaatttcagattttggc 4275
Score = 83.8 bits (42), Expect = 3e-15
Identities = 93/110 (84%)
Strand = Plus / Plus
Query: 1015 gctaggggccttctctatcttcatcaagattcaagacttagaattatacacagagatctc 1074
||||| || ||||| |||||||||||||| || ||||| |||||||| || |||||||||
Sbjct: 1786 gctagaggacttctttatcttcatcaagactcgagactaagaattatccatagagatctc 1845
Query: 1075 aaagcaagtaatgtattgcttgataatgagatgaacccgaagatttcaga 1124
||||| |||||||| || || || || || ||||| || |||||||||||
Sbjct: 1846 aaagccagtaatgtgttactggacaaggatatgaatccaaagatttcaga 1895
>30014.m000437 conserved hypothetical protein
Length = 1397
Score = 137 bits (69), Expect = 2e-31
Identities = 105/117 (89%)
Strand = Plus / Plus
Query: 841 gcaaaacttcagcaccgaaatcttgtaaagcttcttggttgctgcattcaaggaaatgaa 900
||||||||||| || |||||| |||||||||||||||| ||||||||||||||| |||||
Sbjct: 1132 gcaaaacttcaacatcgaaattttgtaaagcttcttggctgctgcattcaaggagatgaa 1191
Query: 901 agactgcttatatacgaatacatgccaaacaaaagcctggattacttcatttttgat 957
||| |||| || ||||||||||||||||| ||||| ||||| | |||||||||||||
Sbjct: 1192 agaatgctaatttacgaatacatgccaaataaaagtctggacttcttcatttttgat 1248
Score = 121 bits (61), Expect = 1e-26
Identities = 118/137 (86%)
Strand = Plus / Plus
Query: 1042 gattcaagacttagaattatacacagagatctcaaagcaagtaatgtattgcttgataat 1101
||||||||| | || |||||||| |||||||||||||| |||||| ||||||| ||||||
Sbjct: 1246 gattcaagattgaggattatacatagagatctcaaagccagtaatctattgctcgataat 1305
Query: 1102 gagatgaacccgaagatttcagattttggcatggccaggatttttggaggagaccagact 1161
|||||||| ||||| ||||||||||||||||||| || | |||||||| ||| || |||
Sbjct: 1306 gagatgaatccgaaaatttcagattttggcatggtcaaaacttttggagcagatcaaact 1365
Query: 1162 gagggaaacactaaaag 1178
|| ||||| || |||||
Sbjct: 1366 gaaggaaatacaaaaag 1382
Score = 63.9 bits (32), Expect = 3e-09
Identities = 47/52 (90%)
Strand = Plus / Plus
Query: 171 taacttcatggaaaaattgggatgatccatcaccgggtgaccttgtttggag 222
|||| |||||||| |||||||||||||||||||| || ||| ||||||||||
Sbjct: 341 taacctcatggaagaattgggatgatccatcaccaggagactttgtttggag 392
>28229.m000056 S-locus-specific glycoprotein S6 precursor, putative
Length = 2469
Score = 127 bits (64), Expect = 2e-28
Identities = 124/144 (86%)
Strand = Plus / Plus
Query: 814 gagttcaaaaacgaagttatattgattgcaaaacttcagcaccgaaatcttgtaaagctt 873
||||||||||| |||||||| |||||||||| ||||||||| | |||||||| ||||||
Sbjct: 1633 gagttcaaaaatgaagttattttgattgcaaggcttcagcacaggaatcttgtgaagctt 1692
Query: 874 cttggttgctgcattcaaggaaatgaaagactgcttatatacgaatacatgccaaacaaa 933
||||||||||||||||| ||| |||||| | || | || || ||||||||||| ||||||
Sbjct: 1693 cttggttgctgcattcatggagatgaaaaaatgttgatctatgaatacatgcccaacaaa 1752
Query: 934 agcctggattacttcatttttgat 957
||| |||| | ||| |||||||||
Sbjct: 1753 agcttggactcctttatttttgat 1776
>30014.m000448 conserved hypothetical protein
Length = 7287
Score = 95.6 bits (48), Expect = 8e-19
Identities = 162/200 (81%)
Strand = Plus / Plus
Query: 1018 aggggccttctctatcttcatcaagattcaagacttagaattatacacagagatctcaaa 1077
||||| ||||||||||||||||||||||| ||||| |||||||| || ||||||||||||
Sbjct: 4303 aggggacttctctatcttcatcaagattctagactaagaattattcatagagatctcaaa 4362
Query: 1078 gcaagtaatgtattgcttgataatgagatgaacccgaagatttcagattttggcatggcc 1137
||||| | || || |||||||| ||||| || || || ||||||||||| |||||
Sbjct: 4363 ttgagtaacattttactagataatgatatgaatccaaaaatctcagattttggaatggct 4422
Query: 1138 aggatttttggaggagaccagactgagggaaacactaaaagggtagttggcacatacggt 1197
|||| |||||| || | | || || | ||| || || || |||||||| ||||| |||
Sbjct: 4423 aggagttttgggggcaatgaaaccgaagcaaatacgaatagagtagttggaacatatggt 4482
Query: 1198 tatatggcgccagagtatgc 1217
|||||| | |||||||||||
Sbjct: 4483 tatatgtcaccagagtatgc 4502
Score = 56.0 bits (28), Expect = 7e-07
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 80 tacttatggcagagctttgattatccaactgatacattactagcaggaatgaagattgga 139
||||| |||||||| ||||| |||||| ||||||||||| | | |||||||||||||||
Sbjct: 421 tacttgtggcagagttttgactatccatctgatacattattgcctggaatgaagattgga 480
Score = 54.0 bits (27), Expect = 3e-06
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 1033 cttcatcaagattcaagacttagaattatacacagagatctcaaagc 1079
|||||||||||||||||||| ||||| || || |||||||| |||||
Sbjct: 1864 cttcatcaagattcaagactcagaataattcatagagatctaaaagc 1910
>29615.m000503 serine-threonine protein kinase, plant-type, putative
Length = 4662
Score = 85.7 bits (43), Expect = 8e-16
Identities = 130/159 (81%)
Strand = Plus / Plus
Query: 1105 atgaacccgaagatttcagattttggcatggccaggatttttggaggagaccagactgag 1164
||||||||||||||||| || || ||| |||| ||||| |||| ||| | || || |||
Sbjct: 1864 atgaacccgaagatttctgacttcggcctggcaaggatatttgaaggcaaacaaacagag 1923
Query: 1165 ggaaacactaaaagggtagttggcacatacggttatatggcgccagagtatgccagcgat 1224
|||| ||| | || |||||||| ||||| || |||||| | || |||||||| |||
Sbjct: 1924 ggaagcacaagcagagtagttggaacatatgggtatatgtccccggagtatgcattagat 1983
Query: 1225 gggctattttcagttaagtccgatgtttttagctttggt 1263
||||||||||||||||| || ||||||||||||||||||
Sbjct: 1984 gggctattttcagttaaatcagatgtttttagctttggt 2022
>29842.m003712 S-locus-specific glycoprotein S6 precursor, putative
Length = 2478
Score = 83.8 bits (42), Expect = 3e-15
Identities = 165/206 (80%)
Strand = Plus / Plus
Query: 1012 atagctaggggccttctctatcttcatcaagattcaagacttagaattatacacagagat 1071
||||||||||| ||||| ||||| ||| |||||| ||| | ||||| || ||||| |||
Sbjct: 1843 atagctaggggacttctttatctacatagagattcgagattgagaataatccacagggat 1902
Query: 1072 ctcaaagcaagtaatgtattgcttgataatgagatgaacccgaagatttcagattttggc 1131
|||||||| |||||||| || | |||||| | | || || || || |||||||||||
Sbjct: 1903 ctcaaagccagtaatgttctgttagataatcaattaaatcccaaaatctcagattttgga 1962
Query: 1132 atggccaggatttttggaggagaccagactgagggaaacactaaaagggtagttggcaca 1191
||||| || || ||||| ||||| ||||| || |||||||| || ||| ||||||| ||
Sbjct: 1963 atggcaagaatgtttggtggagatcagacagaaggaaacacaaagaggatagttggaact 2022
Query: 1192 tacggttatatggcgccagagtatgc 1217
|| ||||||||| | ||||| |||||
Sbjct: 2023 tatggttatatgcctccagaatatgc 2048
>29842.m003707 Negative regulator of the PHO system, putative
Length = 4443
Score = 83.8 bits (42), Expect = 3e-15
Identities = 158/194 (81%), Gaps = 2/194 (1%)
Strand = Plus / Plus
Query: 1025 ttctctatcttcatcaagattcaagacttagaattatacacagagatctcaaagcaagta 1084
|||| ||||||||||||||||||||| | ||||| || |||||||||||||| || ||||
Sbjct: 3818 ttctatatcttcatcaagattcaagattaagaatcattcacagagatctcaaggctagta 3877
Query: 1085 atgtattgcttgat-aatgagatgaacccgaagatttcagattttggcatggccaggatt 1143
|||| ||| | ||| || | ||||| || || |||||||||||||||||||| || ||
Sbjct: 3878 atgttttgttggatgcatca-atgaatccaaaaatttcagattttggcatggctagaata 3936
Query: 1144 tttggaggagaccagactgagggaaacactaaaagggtagttggcacatacggttatatg 1203
|||||| ||||| | ||| | |||||| || |||| ||||| ||||| |||||||||
Sbjct: 3937 gttggagttgaccaaattgaagcaaacacaaatcgggtggttggaacatatggttatatg 3996
Query: 1204 gcgccagagtatgc 1217
| ||||| |||||
Sbjct: 3997 tcaccagaatatgc 4010
>29933.m001463 S-locus-specific glycoprotein S6 precursor, putative
Length = 2550
Score = 77.8 bits (39), Expect = 2e-13
Identities = 84/99 (84%)
Strand = Plus / Plus
Query: 1105 atgaacccgaagatttcagattttggcatggccaggatttttggaggagaccagactgag 1164
||||| || |||||||||||||||||||||||||| || ||||||||| |||| | |||
Sbjct: 1999 atgaatcctaagatttcagattttggcatggccagaatctttggaggaaaccaaaatgaa 2058
Query: 1165 ggaaacactaaaagggtagttggcacatacggttatatg 1203
|||||| || || || |||||||||||||| ||||||
Sbjct: 2059 ttaaacacaaacagagttgttggcacatacggctatatg 2097
>38590.m000013 S-locus-specific glycoprotein S13 precursor, putative
Length = 1266
Score = 69.9 bits (35), Expect = 5e-11
Identities = 53/59 (89%)
Strand = Plus / Plus
Query: 83 ttatggcagagctttgattatccaactgatacattactagcaggaatgaagattggagt 141
|||||||| ||||||||| ||||||| ||||| ||| || |||||||||||||||||||
Sbjct: 427 ttatggcaaagctttgatcatccaacagataccttattaccaggaatgaagattggagt 485
>29784.m000368 B-Raf proto-oncogene serine/threonine-protein kinase,
putative
Length = 4554
Score = 69.9 bits (35), Expect = 5e-11
Identities = 53/59 (89%)
Strand = Plus / Plus
Query: 83 ttatggcagagctttgattatccaactgatacattactagcaggaatgaagattggagt 141
|||||||| ||||||||| ||||||| ||||| ||| || |||||||||||||||||||
Sbjct: 142 ttatggcaaagctttgatcatccaacagataccttattaccaggaatgaagattggagt 200
Score = 69.9 bits (35), Expect = 5e-11
Identities = 53/59 (89%)
Strand = Plus / Plus
Query: 83 ttatggcagagctttgattatccaactgatacattactagcaggaatgaagattggagt 141
|||||||| ||||||||| ||||||| ||||| ||| || |||||||||||||||||||
Sbjct: 2476 ttatggcaaagctttgatcatccaacagataccttattaccaggaatgaagattggagt 2534
>60621.m000011 S-locus-specific glycoprotein S13 precursor, putative
Length = 1020
Score = 69.9 bits (35), Expect = 5e-11
Identities = 53/59 (89%)
Strand = Plus / Plus
Query: 83 ttatggcagagctttgattatccaactgatacattactagcaggaatgaagattggagt 141
|||||||| ||||||||| ||||||| ||||| ||| || |||||||||||||||||||
Sbjct: 421 ttatggcaaagctttgatcatccaacagataccttattaccaggaatgaagattggagt 479
>28320.m001089 conserved hypothetical protein
Length = 1272
Score = 60.0 bits (30), Expect = 4e-08
Identities = 39/42 (92%)
Strand = Plus / Plus
Query: 913 tacgaatacatgccaaacaaaagcctggattacttcattttt 954
|||||||||||||| ||||||||| |||||| ||||||||||
Sbjct: 763 tacgaatacatgcccaacaaaagcttggattccttcattttt 804
>30014.m000454 S-locus-specific glycoprotein S6 precursor, putative
Length = 2280
Score = 58.0 bits (29), Expect = 2e-07
Identities = 65/77 (84%)
Strand = Plus / Plus
Query: 814 gagttcaaaaacgaagttatattgattgcaaaacttcagcaccgaaatcttgtaaagctt 873
||||||||||| || ||||| ||||| | ||||||||||| |||||||||| || |||
Sbjct: 1624 gagttcaaaaatgaggttatcttgatctctgaacttcagcacagaaatcttgttaaactt 1683
Query: 874 cttggttgctgcattca 890
||||| || ||||||||
Sbjct: 1684 cttggctgttgcattca 1700
>29842.m003666 ATP binding protein, putative
Length = 2025
Score = 54.0 bits (27), Expect = 3e-06
Identities = 48/55 (87%)
Strand = Plus / Plus
Query: 1096 gataatgagatgaacccgaagatttcagattttggcatggccaggatttttggag 1150
||||| || ||||| || || |||||||||||||| |||||||| ||||||||||
Sbjct: 1444 gataaggatatgaatccaaaaatttcagattttggtatggccagaatttttggag 1498