Jatropha Genome Database

JcCB0245251.10
Show Alignment: 
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0245251.10 + phase: 0 /pseudo/partial
         (1650 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30014.m000456 ATP binding protein, putative                           139   6e-32
30014.m000437 conserved hypothetical protein                          137   2e-31
28229.m000056 S-locus-specific glycoprotein S6 precursor, putative    127   2e-28
30014.m000448 conserved hypothetical protein                           96   8e-19
29615.m000503 serine-threonine protein kinase, plant-type, putative    86   8e-16
29842.m003712 S-locus-specific glycoprotein S6 precursor, putative     84   3e-15
29842.m003707 Negative regulator of the PHO system, putative           84   3e-15
29933.m001463 S-locus-specific glycoprotein S6 precursor, putative     78   2e-13
38590.m000013 S-locus-specific glycoprotein S13 precursor, putative    70   5e-11
29784.m000368 B-Raf proto-oncogene serine/threonine-protein kina...    70   5e-11
60621.m000011 S-locus-specific glycoprotein S13 precursor, putative    70   5e-11
28320.m001089 conserved hypothetical protein                           60   4e-08
30014.m000454 S-locus-specific glycoprotein S6 precursor, putative     58   2e-07
29842.m003666 ATP binding protein, putative                            54   3e-06

>30014.m000456 ATP binding protein, putative
          Length = 4794

 Score =  139 bits (70), Expect = 6e-32
 Identities = 265/330 (80%)
 Strand = Plus / Plus

                                                                        
Query: 802  caaggattaatcgagttcaaaaacgaagttatattgattgcaaaacttcagcaccgaaat 861
            |||||||| | |||||||||||| ||||| ||||| || || | |||||||||||| |||
Sbjct: 3946 caaggattgaacgagttcaaaaatgaagtaatattaatagccagacttcagcaccgtaat 4005

                                                                        
Query: 862  cttgtaaagcttcttggttgctgcattcaaggaaatgaaagactgcttatatacgaatac 921
            ||||||||||||||||||||||||| ||| | | |||| | | || | || || ||||||
Sbjct: 4006 cttgtaaagcttcttggttgctgcactcatgaagatgagaaaatgttaatctatgaatac 4065

                                                                        
Query: 922  atgccaaacaaaagcctggattacttcatttttgatcaaactagaggaaaactattagat 981
            ||||| ||||||||| |||| | ||| ||||||||| |||  ||| | ||| || |||||
Sbjct: 4066 atgcctaacaaaagcttggacttctttatttttgataaaatgagaagcaaattactagat 4125

                                                                        
Query: 982  tggtccaagcgtttcaacattatgtgcgcaatagctaggggccttctctatcttcatcaa 1041
            |||   || || ||| |||| ||  | | ||| ||| | || ||||| ||||||||||||
Sbjct: 4126 tggcataaacggttccacatcattggtggaattgctcgaggtcttctttatcttcatcaa 4185

                                                                        
Query: 1042 gattcaagacttagaattatacacagagatctcaaagcaagtaatgtattgcttgataat 1101
            || || ||||| | ||| || ||| ||||||||||||| |||||  | ||  | ||||||
Sbjct: 4186 gactctagactaaaaatcattcaccgagatctcaaagccagtaacattttattggataat 4245

                                          
Query: 1102 gagatgaacccgaagatttcagattttggc 1131
            || ||||| ||||| |||||||||||||||
Sbjct: 4246 gaaatgaatccgaaaatttcagattttggc 4275



 Score = 83.8 bits (42), Expect = 3e-15
 Identities = 93/110 (84%)
 Strand = Plus / Plus

                                                                        
Query: 1015 gctaggggccttctctatcttcatcaagattcaagacttagaattatacacagagatctc 1074
            ||||| || ||||| |||||||||||||| || ||||| |||||||| || |||||||||
Sbjct: 1786 gctagaggacttctttatcttcatcaagactcgagactaagaattatccatagagatctc 1845

                                                              
Query: 1075 aaagcaagtaatgtattgcttgataatgagatgaacccgaagatttcaga 1124
            ||||| |||||||| || || || || || ||||| || |||||||||||
Sbjct: 1846 aaagccagtaatgtgttactggacaaggatatgaatccaaagatttcaga 1895


>30014.m000437 conserved hypothetical protein
          Length = 1397

 Score =  137 bits (69), Expect = 2e-31
 Identities = 105/117 (89%)
 Strand = Plus / Plus

                                                                        
Query: 841  gcaaaacttcagcaccgaaatcttgtaaagcttcttggttgctgcattcaaggaaatgaa 900
            ||||||||||| || |||||| |||||||||||||||| ||||||||||||||| |||||
Sbjct: 1132 gcaaaacttcaacatcgaaattttgtaaagcttcttggctgctgcattcaaggagatgaa 1191

                                                                     
Query: 901  agactgcttatatacgaatacatgccaaacaaaagcctggattacttcatttttgat 957
            ||| |||| || ||||||||||||||||| ||||| ||||| | |||||||||||||
Sbjct: 1192 agaatgctaatttacgaatacatgccaaataaaagtctggacttcttcatttttgat 1248



 Score =  121 bits (61), Expect = 1e-26
 Identities = 118/137 (86%)
 Strand = Plus / Plus

                                                                        
Query: 1042 gattcaagacttagaattatacacagagatctcaaagcaagtaatgtattgcttgataat 1101
            ||||||||| | || |||||||| |||||||||||||| |||||| ||||||| ||||||
Sbjct: 1246 gattcaagattgaggattatacatagagatctcaaagccagtaatctattgctcgataat 1305

                                                                        
Query: 1102 gagatgaacccgaagatttcagattttggcatggccaggatttttggaggagaccagact 1161
            |||||||| ||||| ||||||||||||||||||| ||  | |||||||| ||| || |||
Sbjct: 1306 gagatgaatccgaaaatttcagattttggcatggtcaaaacttttggagcagatcaaact 1365

                             
Query: 1162 gagggaaacactaaaag 1178
            || ||||| || |||||
Sbjct: 1366 gaaggaaatacaaaaag 1382



 Score = 63.9 bits (32), Expect = 3e-09
 Identities = 47/52 (90%)
 Strand = Plus / Plus

                                                               
Query: 171 taacttcatggaaaaattgggatgatccatcaccgggtgaccttgtttggag 222
           |||| |||||||| |||||||||||||||||||| || ||| ||||||||||
Sbjct: 341 taacctcatggaagaattgggatgatccatcaccaggagactttgtttggag 392


>28229.m000056 S-locus-specific glycoprotein S6 precursor, putative
          Length = 2469

 Score =  127 bits (64), Expect = 2e-28
 Identities = 124/144 (86%)
 Strand = Plus / Plus

                                                                        
Query: 814  gagttcaaaaacgaagttatattgattgcaaaacttcagcaccgaaatcttgtaaagctt 873
            ||||||||||| |||||||| ||||||||||  ||||||||| | |||||||| ||||||
Sbjct: 1633 gagttcaaaaatgaagttattttgattgcaaggcttcagcacaggaatcttgtgaagctt 1692

                                                                        
Query: 874  cttggttgctgcattcaaggaaatgaaagactgcttatatacgaatacatgccaaacaaa 933
            ||||||||||||||||| ||| |||||| | || | || || ||||||||||| ||||||
Sbjct: 1693 cttggttgctgcattcatggagatgaaaaaatgttgatctatgaatacatgcccaacaaa 1752

                                    
Query: 934  agcctggattacttcatttttgat 957
            ||| |||| | ||| |||||||||
Sbjct: 1753 agcttggactcctttatttttgat 1776


>30014.m000448 conserved hypothetical protein
          Length = 7287

 Score = 95.6 bits (48), Expect = 8e-19
 Identities = 162/200 (81%)
 Strand = Plus / Plus

                                                                        
Query: 1018 aggggccttctctatcttcatcaagattcaagacttagaattatacacagagatctcaaa 1077
            ||||| ||||||||||||||||||||||| ||||| |||||||| || ||||||||||||
Sbjct: 4303 aggggacttctctatcttcatcaagattctagactaagaattattcatagagatctcaaa 4362

                                                                        
Query: 1078 gcaagtaatgtattgcttgataatgagatgaacccgaagatttcagattttggcatggcc 1137
               |||||  | || || |||||||| ||||| || || || ||||||||||| ||||| 
Sbjct: 4363 ttgagtaacattttactagataatgatatgaatccaaaaatctcagattttggaatggct 4422

                                                                        
Query: 1138 aggatttttggaggagaccagactgagggaaacactaaaagggtagttggcacatacggt 1197
            |||| |||||| ||  |  | || || | ||| || || || |||||||| ||||| |||
Sbjct: 4423 aggagttttgggggcaatgaaaccgaagcaaatacgaatagagtagttggaacatatggt 4482

                                
Query: 1198 tatatggcgccagagtatgc 1217
            |||||| | |||||||||||
Sbjct: 4483 tatatgtcaccagagtatgc 4502



 Score = 56.0 bits (28), Expect = 7e-07
 Identities = 52/60 (86%)
 Strand = Plus / Plus

                                                                       
Query: 80  tacttatggcagagctttgattatccaactgatacattactagcaggaatgaagattgga 139
           ||||| |||||||| ||||| |||||| ||||||||||| |  | |||||||||||||||
Sbjct: 421 tacttgtggcagagttttgactatccatctgatacattattgcctggaatgaagattgga 480



 Score = 54.0 bits (27), Expect = 3e-06
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                           
Query: 1033 cttcatcaagattcaagacttagaattatacacagagatctcaaagc 1079
            |||||||||||||||||||| ||||| || || |||||||| |||||
Sbjct: 1864 cttcatcaagattcaagactcagaataattcatagagatctaaaagc 1910


>29615.m000503 serine-threonine protein kinase, plant-type, putative
          Length = 4662

 Score = 85.7 bits (43), Expect = 8e-16
 Identities = 130/159 (81%)
 Strand = Plus / Plus

                                                                        
Query: 1105 atgaacccgaagatttcagattttggcatggccaggatttttggaggagaccagactgag 1164
            ||||||||||||||||| || || ||| |||| ||||| |||| |||  | || || |||
Sbjct: 1864 atgaacccgaagatttctgacttcggcctggcaaggatatttgaaggcaaacaaacagag 1923

                                                                        
Query: 1165 ggaaacactaaaagggtagttggcacatacggttatatggcgccagagtatgccagcgat 1224
            |||| ||| |  || |||||||| ||||| || |||||| | || ||||||||    |||
Sbjct: 1924 ggaagcacaagcagagtagttggaacatatgggtatatgtccccggagtatgcattagat 1983

                                                   
Query: 1225 gggctattttcagttaagtccgatgtttttagctttggt 1263
            ||||||||||||||||| || ||||||||||||||||||
Sbjct: 1984 gggctattttcagttaaatcagatgtttttagctttggt 2022


>29842.m003712 S-locus-specific glycoprotein S6 precursor, putative
          Length = 2478

 Score = 83.8 bits (42), Expect = 3e-15
 Identities = 165/206 (80%)
 Strand = Plus / Plus

                                                                        
Query: 1012 atagctaggggccttctctatcttcatcaagattcaagacttagaattatacacagagat 1071
            ||||||||||| ||||| ||||| |||  |||||| ||| | ||||| || ||||| |||
Sbjct: 1843 atagctaggggacttctttatctacatagagattcgagattgagaataatccacagggat 1902

                                                                        
Query: 1072 ctcaaagcaagtaatgtattgcttgataatgagatgaacccgaagatttcagattttggc 1131
            |||||||| ||||||||  || | |||||| |  | || || || || ||||||||||| 
Sbjct: 1903 ctcaaagccagtaatgttctgttagataatcaattaaatcccaaaatctcagattttgga 1962

                                                                        
Query: 1132 atggccaggatttttggaggagaccagactgagggaaacactaaaagggtagttggcaca 1191
            ||||| || || ||||| ||||| ||||| || |||||||| || ||| ||||||| || 
Sbjct: 1963 atggcaagaatgtttggtggagatcagacagaaggaaacacaaagaggatagttggaact 2022

                                      
Query: 1192 tacggttatatggcgccagagtatgc 1217
            || ||||||||| | ||||| |||||
Sbjct: 2023 tatggttatatgcctccagaatatgc 2048


>29842.m003707 Negative regulator of the PHO system, putative
          Length = 4443

 Score = 83.8 bits (42), Expect = 3e-15
 Identities = 158/194 (81%), Gaps = 2/194 (1%)
 Strand = Plus / Plus

                                                                        
Query: 1025 ttctctatcttcatcaagattcaagacttagaattatacacagagatctcaaagcaagta 1084
            |||| ||||||||||||||||||||| | ||||| || |||||||||||||| || ||||
Sbjct: 3818 ttctatatcttcatcaagattcaagattaagaatcattcacagagatctcaaggctagta 3877

                                                                        
Query: 1085 atgtattgcttgat-aatgagatgaacccgaagatttcagattttggcatggccaggatt 1143
            |||| ||| | |||  || | ||||| || || |||||||||||||||||||| || || 
Sbjct: 3878 atgttttgttggatgcatca-atgaatccaaaaatttcagattttggcatggctagaata 3936

                                                                        
Query: 1144 tttggaggagaccagactgagggaaacactaaaagggtagttggcacatacggttatatg 1203
             ||||||  ||||| | ||| | |||||| ||  |||| ||||| ||||| |||||||||
Sbjct: 3937 gttggagttgaccaaattgaagcaaacacaaatcgggtggttggaacatatggttatatg 3996

                          
Query: 1204 gcgccagagtatgc 1217
             | ||||| |||||
Sbjct: 3997 tcaccagaatatgc 4010


>29933.m001463 S-locus-specific glycoprotein S6 precursor, putative
          Length = 2550

 Score = 77.8 bits (39), Expect = 2e-13
 Identities = 84/99 (84%)
 Strand = Plus / Plus

                                                                        
Query: 1105 atgaacccgaagatttcagattttggcatggccaggatttttggaggagaccagactgag 1164
            ||||| || |||||||||||||||||||||||||| || ||||||||| |||| | ||| 
Sbjct: 1999 atgaatcctaagatttcagattttggcatggccagaatctttggaggaaaccaaaatgaa 2058

                                                   
Query: 1165 ggaaacactaaaagggtagttggcacatacggttatatg 1203
              |||||| || || || |||||||||||||| ||||||
Sbjct: 2059 ttaaacacaaacagagttgttggcacatacggctatatg 2097


>38590.m000013 S-locus-specific glycoprotein S13 precursor, putative
          Length = 1266

 Score = 69.9 bits (35), Expect = 5e-11
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                      
Query: 83  ttatggcagagctttgattatccaactgatacattactagcaggaatgaagattggagt 141
           |||||||| ||||||||| ||||||| ||||| ||| || |||||||||||||||||||
Sbjct: 427 ttatggcaaagctttgatcatccaacagataccttattaccaggaatgaagattggagt 485


>29784.m000368 B-Raf proto-oncogene serine/threonine-protein kinase,
           putative
          Length = 4554

 Score = 69.9 bits (35), Expect = 5e-11
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                      
Query: 83  ttatggcagagctttgattatccaactgatacattactagcaggaatgaagattggagt 141
           |||||||| ||||||||| ||||||| ||||| ||| || |||||||||||||||||||
Sbjct: 142 ttatggcaaagctttgatcatccaacagataccttattaccaggaatgaagattggagt 200



 Score = 69.9 bits (35), Expect = 5e-11
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                       
Query: 83   ttatggcagagctttgattatccaactgatacattactagcaggaatgaagattggagt 141
            |||||||| ||||||||| ||||||| ||||| ||| || |||||||||||||||||||
Sbjct: 2476 ttatggcaaagctttgatcatccaacagataccttattaccaggaatgaagattggagt 2534


>60621.m000011 S-locus-specific glycoprotein S13 precursor, putative
          Length = 1020

 Score = 69.9 bits (35), Expect = 5e-11
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                      
Query: 83  ttatggcagagctttgattatccaactgatacattactagcaggaatgaagattggagt 141
           |||||||| ||||||||| ||||||| ||||| ||| || |||||||||||||||||||
Sbjct: 421 ttatggcaaagctttgatcatccaacagataccttattaccaggaatgaagattggagt 479


>28320.m001089 conserved hypothetical protein
          Length = 1272

 Score = 60.0 bits (30), Expect = 4e-08
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 913 tacgaatacatgccaaacaaaagcctggattacttcattttt 954
           |||||||||||||| ||||||||| |||||| ||||||||||
Sbjct: 763 tacgaatacatgcccaacaaaagcttggattccttcattttt 804


>30014.m000454 S-locus-specific glycoprotein S6 precursor, putative
          Length = 2280

 Score = 58.0 bits (29), Expect = 2e-07
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                        
Query: 814  gagttcaaaaacgaagttatattgattgcaaaacttcagcaccgaaatcttgtaaagctt 873
            ||||||||||| || ||||| |||||  |  ||||||||||| |||||||||| || |||
Sbjct: 1624 gagttcaaaaatgaggttatcttgatctctgaacttcagcacagaaatcttgttaaactt 1683

                             
Query: 874  cttggttgctgcattca 890
            ||||| || ||||||||
Sbjct: 1684 cttggctgttgcattca 1700


>29842.m003666 ATP binding protein, putative
          Length = 2025

 Score = 54.0 bits (27), Expect = 3e-06
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                   
Query: 1096 gataatgagatgaacccgaagatttcagattttggcatggccaggatttttggag 1150
            ||||| || ||||| || || |||||||||||||| |||||||| ||||||||||
Sbjct: 1444 gataaggatatgaatccaaaaatttcagattttggtatggccagaatttttggag 1498