Jatropha Genome Database

JcCB0242781.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0242781.10 + phase: 1 /partial
         (1058 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29842.m003528 conserved hypothetical protein                          125   6e-28

>29842.m003528 conserved hypothetical protein
          Length = 1077

 Score =  125 bits (63), Expect = 6e-28
 Identities = 146/174 (83%), Gaps = 6/174 (3%)
 Strand = Plus / Plus

                                                                       
Query: 495 gagttgaatatcaatatatggccattcgcacgcagtagatccgaggggaacagcgcatcc 554
           ||||||||||||||||||||||| ||  |||||||||||||||  ||||| || | | ||
Sbjct: 469 gagttgaatatcaatatatggcccttttcacgcagtagatccgctgggaatagtggagcc 528

                                                                       
Query: 555 cgacccaggatgtttcccggagctcctggagcccgcaaggtgagtagcgcgccttgctca 614
           ||||||| ||||||||||||| || |      ||| ||||| || ||||| |||||||||
Sbjct: 529 cgacccacgatgtttcccggaactac------ccgtaaggtcagcagcgccccttgctca 582

                                                                 
Query: 615 cgtagtaattcagcaggggagtcgaagtccaggaagtggcctaccagtccgggt 668
           || ||||||||||| || ||||| |||||||||||||||||||  |||||||||
Sbjct: 583 cggagtaattcagctggagagtccaagtccaggaagtggcctagtagtccgggt 636



 Score =  123 bits (62), Expect = 2e-27
 Identities = 134/158 (84%)
 Strand = Plus / Plus

                                                                       
Query: 82  gcagcggtggaagaagaagcagcgattccaattctcccgaatttgagttttggatgctcc 141
           |||||||  |||||||||||||||| ||||| || || |||||||||||||||| | | |
Sbjct: 56  gcagcggaagaagaagaagcagcgactccaactcccctgaatttgagttttggagggtac 115

                                                                       
Query: 142 agaatccgtcttttccggagcccaatctcctctccgctgatgaactctttgttgatggtg 201
             ||||| |||||||| || |||||| | |||||||| ||||||||||||||||||||||
Sbjct: 116 caaatccctcttttcctgaacccaatattctctccgccgatgaactctttgttgatggtg 175

                                                 
Query: 202 tccttcttcctctccacttactccccctccacaaccac 239
           | || || ||||||||| | || | |||||||||||||
Sbjct: 176 ttctcctccctctccacctgctgcacctccacaaccac 213