Jatropha Genome Database

JcCB0237221.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0237221.10 + phase: 0 
         (603 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29848.m004617 ATP binding protein, putative                           111   5e-24
29927.m000601 hypothetical protein                                     54   1e-06

>29848.m004617 ATP binding protein, putative
          Length = 2688

 Score =  111 bits (56), Expect = 5e-24
 Identities = 83/92 (90%)
 Strand = Plus / Plus

                                                                       
Query: 361 tatgtgaaggtgaaaatggaaggagtggcaatagcaagaaaagtcgatcttaggcttttc 420
           ||||| |||||||| ||||||||||| ||||||||||||||  | ||||| |||||||||
Sbjct: 442 tatgtcaaggtgaagatggaaggagttgcaatagcaagaaagattgatctgaggcttttc 501

                                           
Query: 421 cactcttatcaaacacttacaaactccttgat 452
           || |||||||||||||||||||||| ||||||
Sbjct: 502 cattcttatcaaacacttacaaacttcttgat 533



 Score = 87.7 bits (44), Expect = 7e-17
 Identities = 77/88 (87%)
 Strand = Plus / Plus

                                                                       
Query: 497 tgacgtacctagacaaagatggagactggctacttgcagcagacgtaccatggcagactt 556
           |||| |||| ||| ||||||||||||||||||||||||| ||| || || ||||||||||
Sbjct: 590 tgacataccaagataaagatggagactggctacttgcaggagatgttccgtggcagactt 649

                                       
Query: 557 tcactgagtctgtgcagcgtctggagtt 584
           |||  || || |||||||||||||||||
Sbjct: 650 tcatggaatcagtgcagcgtctggagtt 677



 Score = 63.9 bits (32), Expect = 1e-09
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                       
Query: 133 cctttgcttttatggagtggacaccctaatgacgaagatgatga 176
           |||||||||| ||||||||| || ||||||||||||||||||||
Sbjct: 172 cctttgctttcatggagtggtcagcctaatgacgaagatgatga 215


>29927.m000601 hypothetical protein
          Length = 753

 Score = 54.0 bits (27), Expect = 1e-06
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 364 gtgaaggtgaaaatggaaggagtggcaatagcaagaaaa 402
           ||||||||||||||||| ||||| || ||||||||||||
Sbjct: 499 gtgaaggtgaaaatggatggagtagctatagcaagaaaa 537