Jatropha Genome Database
- JcCB0234681.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0234681.10 + phase: 0 /partial
(456 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
30221.m002218 mads box protein, putative 343 6e-94
>30221.m002218 mads box protein, putative
Length = 702
Score = 343 bits (173), Expect = 6e-94
Identities = 317/365 (86%)
Strand = Plus / Plus
Query: 88 ggtgaggacatgagttccattccttttgatgatttagatgaactcgaacaagaactagaa 147
||||| |||||||| || ||||| ||||| || || | ||||| ||||||||||||||
Sbjct: 331 ggtgaagacatgagctctattccatttgaggagttgggggaacttgaacaagaactagag 390
Query: 148 cgctctgttgccaaggtccgcaaccggaagaatgagctcttgcagcagcaactggataat 207
||||| || |||||||| || |||||||||||||||||||||| ||||| |||||||||
Sbjct: 391 cgctccgtggccaaggttcgggaccggaagaatgagctcttgcaacagcagctggataat 450
Query: 208 ctgcacaggaaggagcgaatgttggaggaggaaaatggcaatatgtaccgttggatccag 267
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 451 ctgcgcaggaaggagcgaatgttggaggaggaaaatggcaatatgtaccgttggattcag 510
Query: 268 gatcatcgcgtggcaatggagtatcagcacgcgacactggaagcaaagccagtggagcat 327
|| ||||||| || ||||||| ||||| |||||| ||||||||||||||||||| |||
Sbjct: 511 gagcatcgcgcagcgctggagtaccagcaggcgacaatggaagcaaagccagtggaacat 570
Query: 328 caacaagttcttgatcaattcccattttgtggagaaccgagtagtgtccttcagcttgga 387
|| |||||||| ||||| |||||||| ||||| || || | |||||||||||||| | |
Sbjct: 571 cagcaagttctggatcagttcccattctgtggggagcctaacagtgtccttcagctcgca 630
Query: 388 accattcattctcaaatccattcataccatctgcagcttgctcagcccaaccttcaaggt 447
||||||| |||||||| ||| |||||||||| ||||| |||||||| || |||||||||
Sbjct: 631 accattccctctcaaattcatccataccatctccagctcgctcagccaaatcttcaaggt 690
Query: 448 tctag 452
|||||
Sbjct: 691 tctag 695