Jatropha Genome Database

JcCB0233111.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0233111.10 - phase: 0 
         (468 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29822.m003391 aberrant large forked product, putative                  86   2e-16
29827.m002649 conserved hypothetical protein                           82   3e-15
29822.m003386 conserved hypothetical protein                           82   3e-15

>29822.m003391 aberrant large forked product, putative
          Length = 1032

 Score = 85.7 bits (43), Expect = 2e-16
 Identities = 96/113 (84%), Gaps = 3/113 (2%)
 Strand = Plus / Plus

                                                                       
Query: 212 cagaaagagtgcagggagtttgggaagaccctgatgatggtagtgatagtgattatgatg 271
           |||||||| ||| ||||||||||||||| |||||||| |||||||  |||||||||||||
Sbjct: 185 cagaaagattgccgggagtttgggaagatcctgatgacggtagtggcagtgattatgatg 244

                                                                
Query: 272 aagaaaatgaggaaattgaagcaaatgatttggattatgagagtgattgggag 324
           |||    ||| ||| | |||| ||||||  |||||||||| ||||||||||||
Sbjct: 245 aag---ttgaagaattggaagaaaatgacatggattatgaaagtgattgggag 294


>29827.m002649 conserved hypothetical protein
          Length = 414

 Score = 81.8 bits (41), Expect = 3e-15
 Identities = 96/113 (84%), Gaps = 1/113 (0%)
 Strand = Plus / Plus

                                                                       
Query: 212 cagaaagagtgcagggagtttgggaagaccctgatgatggtagtgatagtgattatgatg 271
           |||||||||||| ||| |||||||||||  ||||||| |||| ||  |||||||||||||
Sbjct: 269 cagaaagagtgccggg-gtttgggaagattctgatgacggtattggcagtgattatgatg 327

                                                                
Query: 272 aagaaaatgaggaaattgaagcaaatgatttggattatgagagtgattgggag 324
           |||||  ||||||| | |||| ||||||  ||||||||||||| |||| ||||
Sbjct: 328 aagaagttgaggaattggaagaaaatgacatggattatgagagagattaggag 380


>29822.m003386 conserved hypothetical protein
          Length = 507

 Score = 81.8 bits (41), Expect = 3e-15
 Identities = 95/113 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 cagaaagagtgcagggagtttgggaagaccctgatgatggtagtgatagtgattatgatg 271
           |||||||| ||| ||||||||||||||  || |||||  ||||||  |||||||||||||
Sbjct: 290 cagaaagattgccgggagtttgggaagttccggatgactgtagtggaagtgattatgatg 349

                                                                
Query: 272 aagaaaatgaggaaattgaagcaaatgatttggattatgagagtgattgggag 324
           |||||| ||| ||| | ||||   ||||  |||||||||||||||||||||||
Sbjct: 350 aagaaattgaagaattggaagagtatgacatggattatgagagtgattgggag 402