Jatropha Genome Database

JcCB0231061.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0231061.10 + phase: 0 /partial
         (408 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29269.m000248 Receptor protein kinase CLAVATA1 precursor, putative    125   2e-28

>29269.m000248 Receptor protein kinase CLAVATA1 precursor, putative
          Length = 2157

 Score =  125 bits (63), Expect = 2e-28
 Identities = 218/269 (81%), Gaps = 3/269 (1%)
 Strand = Plus / Plus

                                                                        
Query: 26   ttttggagcttttaacaggacggaaagcttttgatagctcaagaccaagtgaagagcaat 85
            |||||||||| ||||||||| ||||| |||||||||||||||   | ||  | |||||||
Sbjct: 1778 ttttggagctattaacaggaaggaaaccttttgatagctcaaagtctagaaaggagcaat 1837

                                                                        
Query: 86   cattggtaaaatgggcttcatgtcgtcttcatgataatgcatctttggaactaatggtag 145
            || ||| |||||||||||||| ||| |||||||||||||| | ||||| ||  ||||| |
Sbjct: 1838 cactggcaaaatgggcttcatctcggcttcatgataatgcgtatttggcacagatggttg 1897

                                                                        
Query: 146  atccaggcatcaacataacaacagtctccccaaaagctctctcccaatttgcagatgttg 205
            ||||| ||||||| | ||||    || || | ||  || |||||  || ||||||| | |
Sbjct: 1898 atccaagcatcaagagaacac---tcacctccaagactatctccagatatgcagatatcg 1954

                                                                        
Query: 206  tttcactctgtattcagcctgagatgctattccgaccgcctatgtctgaaattgtggtct 265
            | ||  |||||||||||||||||| | ||||||| || |||||||||||||||||||  |
Sbjct: 1955 tctccttctgtattcagcctgagaagttattccggccacctatgtctgaaattgtggaat 2014

                                         
Query: 266  ctctggcgtcgctgctgcaaaaattcacc 294
            ||||||| || || |||||||| ||||||
Sbjct: 2015 ctctggcatctcttctgcaaaacttcacc 2043