Jatropha Genome Database

JcCB0212191.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0212191.10 + phase: 0 /partial
         (329 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

28629.m000552 conserved hypothetical protein                          105   2e-22

>28629.m000552 conserved hypothetical protein
          Length = 327

 Score =  105 bits (53), Expect = 2e-22
 Identities = 205/255 (80%), Gaps = 3/255 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggatacatcaaaacctgcaatttttgtcaatggtgggctgttgcccatgcatttgagg 60
           |||||||||||||||||||| |||||||| ||||| |   | || || |||||  | || 
Sbjct: 1   atggatacatcaaaacctgccatttttgtgaatggagctttattacctatgcacgtcaga 60

                                                                       
Query: 61  aagagggtccgaacagttgttcaagttcttggatctgatcgtggatctgttattggaaaa 120
           ||||| ||||| |||||  |||||||  ||||||||||||||||| |||| |||||||| 
Sbjct: 61  aagagagtccgtacagtgattcaagtgattggatctgatcgtggagctgtgattggaaag 120

                                                                       
Query: 121 actacagatgatcatcaacttgttgttaaaggcacc---ccgccatctgctgctcttaca 177
            | |  |||||||||||  | ||||| ||||| |||   || || |||||| ||||| ||
Sbjct: 121 tcaagtgatgatcatcagatcgttgtgaaagggaccccacccccttctgctcctctttca 180

                                                                       
Query: 178 aattttgttgaggttattggcattgctgaaagtgacaagtcgatccaagctgaaatatgg 237
           || ||||||||||||||||| |||||||| | |||||| || || |||||||| || |||
Sbjct: 181 aagtttgttgaggttattggtattgctgatactgacaaatctattcaagctgatatttgg 240

                          
Query: 238 acaagcttcggtgac 252
           || | ||| ||||||
Sbjct: 241 accaactttggtgac 255