Jatropha Genome Database

JcCB0206681.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0206681.10 + phase: 0 /partial
         (279 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30147.m014133 mads box protein, putative                              165   2e-40

>30147.m014133 mads box protein, putative
          Length = 642

 Score =  165 bits (83), Expect = 2e-40
 Identities = 137/155 (88%)
 Strand = Plus / Plus

                                                                       
Query: 79  gtgagaggaaagattcaaatgaagaggatcgaaaatgtcaaaagccgacaagtgactttc 138
           |||||||||||||||||||||| |||||| ||||||| || |||| | |||||||| |||
Sbjct: 4   gtgagaggaaagattcaaatgaggaggattgaaaatgccacaagcaggcaagtgaccttc 63

                                                                       
Query: 139 tccaagcgtagaaacgggcttctgaagaaagcttatgagctatctgttctatgcgatgca 198
           || ||||| ||||| |||||| |||||||||||||||||||||| |||||||| ||||||
Sbjct: 64  tcaaagcgaagaaatgggcttttgaagaaagcttatgagctatcagttctatgtgatgca 123

                                              
Query: 199 gaagttgctgtgatgattttttcacaggaaggaag 233
           |||||||| ||||| || ||||| ||| |||||||
Sbjct: 124 gaagttgcagtgatcatcttttcgcagaaaggaag 158