Jatropha Genome Database

JcCB0203531.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0203531.20 - phase: 0 
         (810 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29927.m000629 conserved hypothetical protein                           64   1e-09

>29927.m000629 conserved hypothetical protein
          Length = 879

 Score = 63.9 bits (32), Expect = 1e-09
 Identities = 110/136 (80%)
 Strand = Plus / Plus

                                                                       
Query: 563 tatctatgtatggagatctaatatggaataaccataaggataatgctcgagctcagactt 622
           ||||||||||||  ||| | |||||| | | ||||||||||  | |||| ||| |||| |
Sbjct: 635 tatctatgtatgctgatttgatatggcagagccataaggatgcttctcgggctgagacat 694

                                                                       
Query: 623 atttcgatgaagctgttcagtcttcacctgatgactgttatgttcttgcttcttatgctc 682
           |||||||| |||||||| |  | || ||||||||||||| | |||| || || |||||||
Sbjct: 695 atttcgatcaagctgttaaagcctcccctgatgactgttttattctggcatcatatgctc 754

                           
Query: 683 gattcctatgggatgc 698
           | || |||||||||||
Sbjct: 755 ggtttctatgggatgc 770