Jatropha Genome Database

JcCB0198581.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0198581.10 - phase: 0 /partial
         (248 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30014.m000437 conserved hypothetical protein                           76   1e-13

>30014.m000437 conserved hypothetical protein
          Length = 1397

 Score = 75.8 bits (38), Expect = 1e-13
 Identities = 104/126 (82%)
 Strand = Plus / Plus

                                                                       
Query: 123 tgatggccagaccttagtttcaaaagatggaatttttgagcttggtttctttagtcctgg 182
           ||||||| |||| ||||||||  ||  ||||| ||| |||||||||||||| ||||||||
Sbjct: 33  tgatggcaagacattagtttcgcaaagtggaactttcgagcttggtttcttcagtcctgg 92

                                                                       
Query: 183 tagttccgggaagcgttacttgggaatttggtaccaaaaaattccagttagaactgtcgt 242
           |||  ||  ||| | ||||||||||||||||||| |||| || ||||  ||||| || ||
Sbjct: 93  tagcaccaagaatcattacttgggaatttggtacaaaaatatcccaggcagaaccgttgt 152

                 
Query: 243 ttgggt 248
           ||||||
Sbjct: 153 ttgggt 158