Jatropha Genome Database
- JcCB0190191.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0190191.10 + phase: 2 /partial
(252 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
29908.m006089 isoamylase, putative 256 5e-68
>29908.m006089 isoamylase, putative
Length = 2352
Score = 256 bits (129), Expect = 5e-68
Identities = 219/249 (87%)
Strand = Plus / Plus
Query: 1 ctgtaatcatcctgtggtcatggagctcatcctggacagcctaagacactgggtggcaga 60
|||||| ||||||||||||||||||||||||||||| ||||||||||| ||||| | ||
Sbjct: 1251 ctgtaaccatcctgtggtcatggagctcatcctggaaagcctaagacattgggtcactga 1310
Query: 61 atatcatgtggatggatttcgatttgaccttgccagtatactttgtcgaggaacggatgg 120
|||||||||||||||||| |||||||||||||| ||| |||||||||||||||| |||||
Sbjct: 1311 atatcatgtggatggattccgatttgaccttgcaagtgtactttgtcgaggaacagatgg 1370
Query: 121 ctctccacttgattctcccccagttatcagggcaattgctaaggaccctatcctgtcaag 180
|||| ||| || |||| || || || ||||||||||| || || |||||||||||||
Sbjct: 1371 tactcctcttaatgctcctccggtcattagggcaattgccaaagatgctatcctgtcaag 1430
Query: 181 atgtaaaattattgcagagccttgggattgtggtggcctttatctggttggaaagtttcc 240
||||||||||||| |||| || ||||||||||| || ||||||||||||||||| |||||
Sbjct: 1431 atgtaaaattatttcagaaccctgggattgtggaggtctttatctggttggaaaatttcc 1490
Query: 241 aaactggga 249
||||||||
Sbjct: 1491 taactggga 1499