Jatropha Genome Database

JcCB0189931.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0189931.10 + phase: 0 
         (327 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30174.m008934 mads box protein, putative                              109   1e-23
30147.m014133 mads box protein, putative                               62   2e-09
30138.m003939 mads box protein, putative                               54   5e-07

>30174.m008934 mads box protein, putative
          Length = 735

 Score =  109 bits (55), Expect = 1e-23
 Identities = 139/167 (83%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggggagagggagagtggagttgaagaggatagagaacaagataaacaggcaggtgaca 60
           ||||| ||||| ||||| ||||||||||||||||| ||||| || ||  | || ||||| 
Sbjct: 1   atgggaagaggaagagtagagttgaagaggatagaaaacaaaatcaatcgccaagtgacc 60

                                                                       
Query: 61  tttgcaaagaggagaaatgggttgttgaagaaagcctatgagctttcagtgctttgtgat 120
           ||  | || ||||| ||||| |||||||| ||||| |||||||| || ||||||||||||
Sbjct: 61  ttctctaaaaggaggaatggattgttgaaaaaagcttatgagctgtctgtgctttgtgat 120

                                                          
Query: 121 gctgaggttgcccttatcatcttttctaaccgtggcaagctctatga 167
           ||||||||||| ||||| ||||| || |  ||||| |||||||||||
Sbjct: 121 gctgaggttgctcttattatcttctccagtcgtggaaagctctatga 167


>30147.m014133 mads box protein, putative
          Length = 642

 Score = 61.9 bits (31), Expect = 2e-09
 Identities = 82/99 (82%)
 Strand = Plus / Plus

                                                                       
Query: 48  caggcaggtgacatttgcaaagaggagaaatgggttgttgaagaaagcctatgagctttc 107
           |||||| ||||| ||  ||||| | ||||||||| | ||||||||||| |||||||| ||
Sbjct: 48  caggcaagtgaccttctcaaagcgaagaaatgggcttttgaagaaagcttatgagctatc 107

                                                  
Query: 108 agtgctttgtgatgctgaggttgcccttatcatcttttc 146
           ||| || |||||||| || |||||  | |||||||||||
Sbjct: 108 agttctatgtgatgcagaagttgcagtgatcatcttttc 146


>30138.m003939 mads box protein, putative
          Length = 735

 Score = 54.0 bits (27), Expect = 5e-07
 Identities = 105/131 (80%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggggagagggagagtggagttgaagaggatagagaacaagataaacaggcaggtgaca 60
           ||||||||||| || ||  || ||||||| || || |||||||| || ||||| ||||| 
Sbjct: 1   atggggagaggtagggttcagctgaagagaattgaaaacaagattaataggcaagtgacc 60

                                                                       
Query: 61  tttgcaaagaggagaaatgggttgttgaagaaagcctatgagctttcagtgctttgtgat 120
           ||| |||| || ||   ||| ||||||||||||||| ||||| | || || ||||| |||
Sbjct: 61  ttttcaaaaagaagggctggattgttgaagaaagcccatgagatctctgttctttgcgat 120

                      
Query: 121 gctgaggttgc 131
           ||||| |||||
Sbjct: 121 gctgaagttgc 131