Jatropha Genome Database

JcCB0189361.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0189361.20 - phase: 0 /pseudo/partial
         (231 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30147.m014114 transcription factor, putative                          200   3e-51
29813.m001457 hypothetical protein                                     88   3e-17

>30147.m014114 transcription factor, putative
          Length = 1206

 Score =  200 bits (101), Expect = 3e-51
 Identities = 191/221 (86%)
 Strand = Plus / Minus

                                                                       
Query: 7   gacatacttgaacctgagctacgtagagatatattaagagaagtgaaatttgcagggatt 66
           ||||| |||||||||||||||||||||||||| || | ||||||||||||||| ||||| 
Sbjct: 518 gacatgcttgaacctgagctacgtagagatatgtttaaagaagtgaaatttgctgggata 459

                                                                       
Query: 67  gtaccggtgccggtggcggcgatcactgctggttcggcttgttgaagtaaccattcgatg 126
           ||||| || || || || ||||||||||||||||| ||||||||||||| |||||| |||
Sbjct: 458 gtacctgtccctgtagctgcgatcactgctggttcagcttgttgaagtagccattcaatg 399

                                                                       
Query: 127 gtttccccgtcggatttgtgaccgagttcacgagttagttggaaaaccctagctgcgcag 186
           ||||| || || ||||||||||| ||||| | |||||  |||||||||||||| || || 
Sbjct: 398 gtttcaccatctgatttgtgaccaagttctctagttaactggaaaaccctagcagcacaa 339

                                                    
Query: 187 agagctggcatgcgaattcttcgaccacgtccgtcgacttt 227
           ||||| |||||||||||||| || |||||||| || |||||
Sbjct: 338 agagcaggcatgcgaattctacgcccacgtccatccacttt 298


>29813.m001457 hypothetical protein
          Length = 1263

 Score = 87.7 bits (44), Expect = 3e-17
 Identities = 116/140 (82%)
 Strand = Plus / Minus

                                                                       
Query: 40  ttaagagaagtgaaatttgcagggattgtaccggtgccggtggcggcgatcactgctggt 99
           |||||||||||||| || || || || ||||| || ||||||||||| || || |  |||
Sbjct: 410 ttaagagaagtgaagttggcgggaatagtaccagtaccggtggcggcaataacagaaggt 351

                                                                       
Query: 100 tcggcttgttgaagtaaccattcgatggtttccccgtcggatttgtgaccgagttcacga 159
           || |||||||| | ||||||||| |||||||| ||||| || ||||| || |||||||| 
Sbjct: 350 tcagcttgttgtaataaccattcaatggtttcaccgtcagacttgtggccaagttcacgt 291

                               
Query: 160 gttagttggaaaaccctagc 179
           || ||||| |||||||||||
Sbjct: 290 gtgagttgaaaaaccctagc 271