Jatropha Genome Database

JcCB0189041.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0189041.10 + phase: 1 /pseudo/partial
         (257 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29598.m000467 pentatricopeptide repeat-containing protein, putative    52   2e-06

>29598.m000467 pentatricopeptide repeat-containing protein, putative
          Length = 942

 Score = 52.0 bits (26), Expect = 2e-06
 Identities = 71/86 (82%)
 Strand = Plus / Plus

                                                                       
Query: 138 agtgagaactatgtggctttctcaagtgtttttgcttcagctgaaaggtgggaagacgtg 197
           |||||| | ||||| || || |||| ||||| ||||||||||||||||||||| || || 
Sbjct: 781 agtgaggattatgtagccttgtcaaatgtttatgcttcagctgaaaggtgggaggatgtt 840

                                     
Query: 198 gagatggtgagaaaagaaatgaaggt 223
           || ||  | ||||| |||||||||||
Sbjct: 841 gaaattttaagaaaggaaatgaaggt 866



 Score = 50.1 bits (25), Expect = 6e-06
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 50  tgtaaagttgatgggaatgttgcgttgggtgaaaaagtggcaaagataatact 102
           ||||||||| ||||| ||||||   ||||||| ||||||||||||||| ||||
Sbjct: 685 tgtaaagttcatggggatgttgtaatgggtgagaaagtggcaaagatactact 737