Jatropha Genome Database

JcCB0186601.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0186601.10 - phase: 0 
         (192 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30170.m014175 conserved hypothetical protein                          100   6e-21

>30170.m014175 conserved hypothetical protein
          Length = 627

 Score = 99.6 bits (50), Expect = 6e-21
 Identities = 98/114 (85%)
 Strand = Plus / Plus

                                                                       
Query: 28  atcaagagagcagagatcgatacacgcccaccattccggtcagttaaagaggctgttaca 87
           |||||||  ||||| |||||||| ||  | |||||||| || ||||||||||||||||||
Sbjct: 34  atcaagaaggcagaaatcgatactcgagctccattccgatcggttaaagaggctgttaca 93

                                                                 
Query: 88  ttgttcggcgagaaagttttggccggcgagctctatgctaacaagctcaaagag 141
           ||||| || |||||||||||||| || ||||||| ||| |||||| ||||||||
Sbjct: 94  ttgtttggagagaaagttttggctggggagctctctgccaacaagttcaaagag 147