Jatropha Genome Database

JcCB0186021.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0186021.10 + phase: 0 
         (249 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30128.m008820 40S ribosomal protein S21e, putative                    278   1e-74
29726.m004036 40S ribosomal protein S21e, putative                    107   3e-23

>30128.m008820 40S ribosomal protein S21e, putative
          Length = 249

 Score =  278 bits (140), Expect = 1e-74
 Identities = 221/248 (89%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagaacgacgagggtcagaacatggatctttatatcccaaggaaatgctctgccaca 60
           ||||||||||| ||||| ||||||||||||||||| |||||||| ||||||||||| |||
Sbjct: 1   atgcagaacgaagagggacagaacatggatctttacatcccaagaaaatgctctgctaca 60

                                                                       
Query: 61  aacaggctaatcacttccaaagatcatgcttctgttcagatcaacattggtcacttagat 120
           |||||||| |||||||||||||||||||| ||||||||||| |||||||| || || |||
Sbjct: 61  aacaggcttatcacttccaaagatcatgcatctgttcagattaacattggacatttggat 120

                                                                       
Query: 121 gccaatggtaactacaccggtcaatttaccacttttgctctctgtggtttcgtccgagcc 180
           || |||||| ||||||| |||||||| |||||||||||||||||||| |||||||| || 
Sbjct: 121 gctaatggtcactacactggtcaattcaccacttttgctctctgtggcttcgtccgtgct 180

                                                                       
Query: 181 cagggtgacgctgacagtgcccttgacaggctttggctgaagaagaaggttgaacttcgc 240
           ||||| || ||||||||||| || |||||||||||||  ||||||||||| ||||| || 
Sbjct: 181 cagggcgatgctgacagtgctctcgacaggctttggcaaaagaagaaggtcgaactccgt 240

                   
Query: 241 caacaata 248
           ||||||||
Sbjct: 241 caacaata 248


>29726.m004036 40S ribosomal protein S21e, putative
          Length = 249

 Score =  107 bits (54), Expect = 3e-23
 Identities = 189/234 (80%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagaacgacgagggtcagaacatggatctttatatcccaaggaaatgctctgccaca 60
           ||||||||||| |||||   ||| |||||||| || ||||| |||||||||||||| |||
Sbjct: 1   atgcagaacgaggagggagtgaatatggatctctacatccccaggaaatgctctgcaaca 60

                                                                       
Query: 61  aacaggctaatcacttccaaagatcatgcttctgttcagatcaacattggtcacttagat 120
           || ||||| || ||||| ||||||||||| ||||||||||| ||||| || ||||| |||
Sbjct: 61  aataggctgattacttcaaaagatcatgcatctgttcagattaacatcgggcacttggat 120

                                                                       
Query: 121 gccaatggtaactacaccggtcaatttaccacttttgctctctgtggtttcgtccgagcc 180
           | |  ||| |  || |  ||||||||||| || ||||| || ||||||||  |||| || 
Sbjct: 121 gaccgtggcatttataatggtcaatttactacgtttgccctttgtggttttatccgtgca 180

                                                                 
Query: 181 cagggtgacgctgacagtgcccttgacaggctttggctgaagaagaaggttgaa 234
           ||||| || | |||||||||  ||||  | ||||||| ||||||||| ||||||
Sbjct: 181 cagggggatggtgacagtgcaattgatcgcctttggcagaagaagaaagttgaa 234