Jatropha Genome Database
- JcCB0185341.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0185341.10 + phase: 0
(765 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
29680.m001686 r2r3-myb transcription factor, putative 113 2e-24
30005.m001298 Transcription repressor MYB4, putative 98 9e-20
29895.m000307 conserved hypothetical protein 76 3e-13
30138.m004082 r2r3-myb transcription factor, putative 76 3e-13
29933.m001453 r2r3-myb transcription factor, putative 60 2e-08
29933.m001454 Transcription repressor MYB4, putative 58 8e-08
30076.m004682 r2r3-myb transcription factor, putative 54 1e-06
29602.m000218 r2r3-myb transcription factor, putative 52 5e-06
29005.m000265 r2r3-myb transcription factor, putative 52 5e-06
>29680.m001686 r2r3-myb transcription factor, putative
Length = 543
Score = 113 bits (57), Expect = 2e-24
Identities = 162/197 (82%)
Strand = Plus / Plus
Query: 13 ccttgctgtgagaagatgggattaaagaaagggccatggacttctgaagaagataagatt 72
||||||||||| |||||||| || ||||| || |||||||| ||||||||||| | ||
Sbjct: 13 ccttgctgtgaaaagatgggtttgaagaagggaccatggacgcctgaagaagatcaaatc 72
Query: 73 ttgatttctcatattcaaaaacatggccatagcaattggcgtgcactccctaagcaagct 132
||| ||||| | |||||| ||||||||||||| ||||| ||||| || ||||||||
Sbjct: 73 ttggtttcttacattcaacggtatggccatagcaactggcgagcactgcccaagcaagca 132
Query: 133 ggtttattgagatgtggaaaaagttgcagacttcgctggataaactatttaagaccagac 192
||| |||| || |||||||| |||||||| ||| | ||||||||||| | || |||||
Sbjct: 133 ggtatattaaggtgtggaaagagttgcaggcttagatggataaactacctgaggccagat 192
Query: 193 attaaaagaggaaactt 209
|||||| ||||||||||
Sbjct: 193 attaaacgaggaaactt 209
>30005.m001298 Transcription repressor MYB4, putative
Length = 909
Score = 97.6 bits (49), Expect = 9e-20
Identities = 205/257 (79%)
Strand = Plus / Plus
Query: 7 agagctccttgctgtgagaagatgggattaaagaaagggccatggacttctgaagaagat 66
|||||||||||||||||||| ||||||||||||||||| || |||||| |||| ||||||
Sbjct: 7 agagctccttgctgtgagaaaatgggattaaagaaaggtccctggactcctgaggaagat 66
Query: 67 aagattttgatttctcatattcaaaaacatggccatagcaattggcgtgcactccctaag 126
| || | | | | |||||| || |||| ||| |||||||| | ||||| |||||
Sbjct: 67 caaatacttgtcaattacattcaacaatatggtcatggcaattggagggcacttcctaaa 126
Query: 127 caagctggtttattgagatgtggaaaaagttgcagacttcgctggataaactatttaaga 186
|||||||||||| |||| |||||||| || |||||||| | |||| ||| || | |||
Sbjct: 127 caagctggtttactgaggtgtggaaagagctgcagactgagatggacaaattacctgaga 186
Query: 187 ccagacattaaaagaggaaactttactctagaagaagaagaaactattatcaagttacat 246
|| ||||||||| |||| || || || ||||||||||||||| || || | ||||||
Sbjct: 187 cctgacattaaacgaggcaatttcaccagagaagaagaagaaaccatcattcaattacat 246
Query: 247 gcaacgctcggaaatag 263
| || ||| ||||||||
Sbjct: 247 gaaatgctaggaaatag 263
>29895.m000307 conserved hypothetical protein
Length = 396
Score = 75.8 bits (38), Expect = 3e-13
Identities = 59/66 (89%)
Strand = Plus / Plus
Query: 693 tattatcgacgatggtatggacttctggtacaatctttttgtaaactctgggggcataga 752
|||||| || |||||||||||||||||||||||| ||||||| || |||||||||||||
Sbjct: 324 tattattgatgatggtatggacttctggtacaatgtttttgttaaagctgggggcataga 383
Query: 753 ggaatt 758
|||||
Sbjct: 384 agaatt 389
Score = 60.0 bits (30), Expect = 2e-08
Identities = 30/30 (100%)
Strand = Plus / Plus
Query: 447 gtctcctcagccctcttctagtgatatttc 476
||||||||||||||||||||||||||||||
Sbjct: 66 gtctcctcagccctcttctagtgatatttc 95
>30138.m004082 r2r3-myb transcription factor, putative
Length = 999
Score = 75.8 bits (38), Expect = 3e-13
Identities = 74/86 (86%)
Strand = Plus / Plus
Query: 13 ccttgctgtgagaagatgggattaaagaaagggccatggacttctgaagaagataagatt 72
|||||||||||||| || ||| | ||||||||||||||||| |||||||||||| ||
Sbjct: 19 ccttgctgtgagaaaataggagtgaagaaagggccatggacccctgaagaagatatcatc 78
Query: 73 ttgatttctcatattcaaaaacatgg 98
||| ||||| |||||||| |||||||
Sbjct: 79 ttggtttcttatattcaagaacatgg 104
>29933.m001453 r2r3-myb transcription factor, putative
Length = 1107
Score = 60.0 bits (30), Expect = 2e-08
Identities = 81/98 (82%)
Strand = Plus / Plus
Query: 244 catgcaacgctcggaaatagatggtcagcaattgcagcgaaactaccaggaaggacagac 303
||||||| |||||||||||||||||| |||||||| | ||| |||| ||||| |||||
Sbjct: 241 catgcaatgctcggaaatagatggtctacaattgcaactaaattacctggaagaacagat 300
Query: 304 aacgagattaagaatgtttggcatactcacttgaaaaa 341
||||| || || ||| ||||||||||| || |||||
Sbjct: 301 aacgatataaaaaatcactggcatactcatttaaaaaa 338
>29933.m001454 Transcription repressor MYB4, putative
Length = 1035
Score = 58.0 bits (29), Expect = 8e-08
Identities = 74/89 (83%)
Strand = Plus / Plus
Query: 244 catgcaacgctcggaaatagatggtcagcaattgcagcgaaactaccaggaaggacagac 303
||||||| ||| |||||||||||||| ||||||||||| ||| | || ||||| |||||
Sbjct: 247 catgcaatgctaggaaatagatggtctgcaattgcagctaaatttcctggaagaacagat 306
Query: 304 aacgagattaagaatgtttggcatactca 332
|| || || || ||| ||||||||||||
Sbjct: 307 aatgatataaaaaatcattggcatactca 335
>30076.m004682 r2r3-myb transcription factor, putative
Length = 282
Score = 54.0 bits (27), Expect = 1e-06
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 136 ttattgagatgtggaaaaagttgcagacttcgctggataaactattt 182
|||||||| ||||| |||||||||||||| | ||||||||||||||
Sbjct: 136 ttattgaggtgtgggaaaagttgcagactgagatggataaactattt 182
>29602.m000218 r2r3-myb transcription factor, putative
Length = 801
Score = 52.0 bits (26), Expect = 5e-06
Identities = 47/54 (87%)
Strand = Plus / Plus
Query: 145 tgtggaaaaagttgcagacttcgctggataaactatttaagaccagacattaaa 198
||||| ||||| || |||||||| ||||| |||||||||||||| ||| |||||
Sbjct: 145 tgtggtaaaagctgtagacttcgttggatcaactatttaagacctgaccttaaa 198
>29005.m000265 r2r3-myb transcription factor, putative
Length = 297
Score = 52.0 bits (26), Expect = 5e-06
Identities = 32/34 (94%)
Strand = Plus / Plus
Query: 37 aagaaagggccatggacttctgaagaagataaga 70
||||||||||||||||| |||||||||||||||
Sbjct: 37 aagaaagggccatggacagctgaagaagataaga 70