Jatropha Genome Database

JcCB0185341.10
Show Alignment: 
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0185341.10 + phase: 0 
         (765 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29680.m001686 r2r3-myb transcription factor, putative                 113   2e-24
30005.m001298 Transcription repressor MYB4, putative                   98   9e-20
29895.m000307 conserved hypothetical protein                           76   3e-13
30138.m004082 r2r3-myb transcription factor, putative                  76   3e-13
29933.m001453 r2r3-myb transcription factor, putative                  60   2e-08
29933.m001454 Transcription repressor MYB4, putative                   58   8e-08
30076.m004682 r2r3-myb transcription factor, putative                  54   1e-06
29602.m000218 r2r3-myb transcription factor, putative                  52   5e-06
29005.m000265 r2r3-myb transcription factor, putative                  52   5e-06

>29680.m001686 r2r3-myb transcription factor, putative
          Length = 543

 Score =  113 bits (57), Expect = 2e-24
 Identities = 162/197 (82%)
 Strand = Plus / Plus

                                                                       
Query: 13  ccttgctgtgagaagatgggattaaagaaagggccatggacttctgaagaagataagatt 72
           ||||||||||| |||||||| || ||||| || ||||||||  ||||||||||| | || 
Sbjct: 13  ccttgctgtgaaaagatgggtttgaagaagggaccatggacgcctgaagaagatcaaatc 72

                                                                       
Query: 73  ttgatttctcatattcaaaaacatggccatagcaattggcgtgcactccctaagcaagct 132
           ||| ||||| | ||||||    ||||||||||||| ||||| ||||| || |||||||| 
Sbjct: 73  ttggtttcttacattcaacggtatggccatagcaactggcgagcactgcccaagcaagca 132

                                                                       
Query: 133 ggtttattgagatgtggaaaaagttgcagacttcgctggataaactatttaagaccagac 192
           ||| |||| || |||||||| |||||||| ||| | |||||||||||  | || ||||| 
Sbjct: 133 ggtatattaaggtgtggaaagagttgcaggcttagatggataaactacctgaggccagat 192

                            
Query: 193 attaaaagaggaaactt 209
           |||||| ||||||||||
Sbjct: 193 attaaacgaggaaactt 209


>30005.m001298 Transcription repressor MYB4, putative
          Length = 909

 Score = 97.6 bits (49), Expect = 9e-20
 Identities = 205/257 (79%)
 Strand = Plus / Plus

                                                                       
Query: 7   agagctccttgctgtgagaagatgggattaaagaaagggccatggacttctgaagaagat 66
           |||||||||||||||||||| ||||||||||||||||| || |||||| |||| ||||||
Sbjct: 7   agagctccttgctgtgagaaaatgggattaaagaaaggtccctggactcctgaggaagat 66

                                                                       
Query: 67  aagattttgatttctcatattcaaaaacatggccatagcaattggcgtgcactccctaag 126
            | ||  |  |   | | |||||| || |||| ||| |||||||| | ||||| ||||| 
Sbjct: 67  caaatacttgtcaattacattcaacaatatggtcatggcaattggagggcacttcctaaa 126

                                                                       
Query: 127 caagctggtttattgagatgtggaaaaagttgcagacttcgctggataaactatttaaga 186
           |||||||||||| |||| |||||||| || ||||||||  | |||| ||| ||  | |||
Sbjct: 127 caagctggtttactgaggtgtggaaagagctgcagactgagatggacaaattacctgaga 186

                                                                       
Query: 187 ccagacattaaaagaggaaactttactctagaagaagaagaaactattatcaagttacat 246
           || ||||||||| |||| || || ||   ||||||||||||||| || ||  | ||||||
Sbjct: 187 cctgacattaaacgaggcaatttcaccagagaagaagaagaaaccatcattcaattacat 246

                            
Query: 247 gcaacgctcggaaatag 263
           | || ||| ||||||||
Sbjct: 247 gaaatgctaggaaatag 263


>29895.m000307 conserved hypothetical protein
          Length = 396

 Score = 75.8 bits (38), Expect = 3e-13
 Identities = 59/66 (89%)
 Strand = Plus / Plus

                                                                       
Query: 693 tattatcgacgatggtatggacttctggtacaatctttttgtaaactctgggggcataga 752
           |||||| || |||||||||||||||||||||||| ||||||| ||  |||||||||||||
Sbjct: 324 tattattgatgatggtatggacttctggtacaatgtttttgttaaagctgggggcataga 383

                 
Query: 753 ggaatt 758
            |||||
Sbjct: 384 agaatt 389



 Score = 60.0 bits (30), Expect = 2e-08
 Identities = 30/30 (100%)
 Strand = Plus / Plus

                                         
Query: 447 gtctcctcagccctcttctagtgatatttc 476
           ||||||||||||||||||||||||||||||
Sbjct: 66  gtctcctcagccctcttctagtgatatttc 95


>30138.m004082 r2r3-myb transcription factor, putative
          Length = 999

 Score = 75.8 bits (38), Expect = 3e-13
 Identities = 74/86 (86%)
 Strand = Plus / Plus

                                                                       
Query: 13  ccttgctgtgagaagatgggattaaagaaagggccatggacttctgaagaagataagatt 72
           |||||||||||||| || ||| | |||||||||||||||||  ||||||||||||  || 
Sbjct: 19  ccttgctgtgagaaaataggagtgaagaaagggccatggacccctgaagaagatatcatc 78

                                     
Query: 73  ttgatttctcatattcaaaaacatgg 98
           ||| ||||| |||||||| |||||||
Sbjct: 79  ttggtttcttatattcaagaacatgg 104


>29933.m001453 r2r3-myb transcription factor, putative
          Length = 1107

 Score = 60.0 bits (30), Expect = 2e-08
 Identities = 81/98 (82%)
 Strand = Plus / Plus

                                                                       
Query: 244 catgcaacgctcggaaatagatggtcagcaattgcagcgaaactaccaggaaggacagac 303
           ||||||| ||||||||||||||||||  |||||||| | ||| |||| ||||| ||||| 
Sbjct: 241 catgcaatgctcggaaatagatggtctacaattgcaactaaattacctggaagaacagat 300

                                                 
Query: 304 aacgagattaagaatgtttggcatactcacttgaaaaa 341
           ||||| || || |||   ||||||||||| || |||||
Sbjct: 301 aacgatataaaaaatcactggcatactcatttaaaaaa 338


>29933.m001454 Transcription repressor MYB4, putative
          Length = 1035

 Score = 58.0 bits (29), Expect = 8e-08
 Identities = 74/89 (83%)
 Strand = Plus / Plus

                                                                       
Query: 244 catgcaacgctcggaaatagatggtcagcaattgcagcgaaactaccaggaaggacagac 303
           ||||||| ||| |||||||||||||| ||||||||||| ||| | || ||||| ||||| 
Sbjct: 247 catgcaatgctaggaaatagatggtctgcaattgcagctaaatttcctggaagaacagat 306

                                        
Query: 304 aacgagattaagaatgtttggcatactca 332
           || || || || |||  ||||||||||||
Sbjct: 307 aatgatataaaaaatcattggcatactca 335


>30076.m004682 r2r3-myb transcription factor, putative
          Length = 282

 Score = 54.0 bits (27), Expect = 1e-06
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 136 ttattgagatgtggaaaaagttgcagacttcgctggataaactattt 182
           |||||||| ||||| ||||||||||||||  | ||||||||||||||
Sbjct: 136 ttattgaggtgtgggaaaagttgcagactgagatggataaactattt 182


>29602.m000218 r2r3-myb transcription factor, putative
          Length = 801

 Score = 52.0 bits (26), Expect = 5e-06
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 145 tgtggaaaaagttgcagacttcgctggataaactatttaagaccagacattaaa 198
           ||||| ||||| || |||||||| ||||| |||||||||||||| ||| |||||
Sbjct: 145 tgtggtaaaagctgtagacttcgttggatcaactatttaagacctgaccttaaa 198


>29005.m000265 r2r3-myb transcription factor, putative
          Length = 297

 Score = 52.0 bits (26), Expect = 5e-06
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                            
Query: 37 aagaaagggccatggacttctgaagaagataaga 70
          |||||||||||||||||  |||||||||||||||
Sbjct: 37 aagaaagggccatggacagctgaagaagataaga 70