Jatropha Genome Database

JcCB0182421.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0182421.10 + phase: 1 /partial
         (359 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30170.m013957 cytochrome P450, putative                               117   5e-26
29929.m004802 cytochrome P450, putative                                52   2e-06
30170.m013964 cytochrome P450, putative                                50   9e-06

>30170.m013957 cytochrome P450, putative
          Length = 1593

 Score =  117 bits (59), Expect = 5e-26
 Identities = 191/235 (81%)
 Strand = Plus / Plus

                                                                        
Query: 9    aaaggcacttggcttatgctcaatctctggaaaatccaaagagaccctaatgtatggcca 68
            |||||||||||| | ||| | ||||| ||||| || || |||||||||||||||||||||
Sbjct: 1240 aaaggcacttggttgatgatgaatctttggaagatacatagagaccctaatgtatggcca 1299

                                                                        
Query: 69   gaccctctggaattcagacctgaaaggttccttacgactcataaaaatgttgatgttaga 128
            || |||  ||| ||||  || ||||| || || || ||||||||  |  |||| ||||| 
Sbjct: 1300 gaacctgcggacttcaagccagaaagatttctaacaactcataaggacattgacgttagg 1359

                                                                        
Query: 129  ggcaagaattttgagttgttgccatttggaggtggaagaaggggttgccctgctgtatct 188
            || || |||||||||||| | || ||||||||||| ||||| |  || ||||| ||||||
Sbjct: 1360 gggaataattttgagttgcttccttttggaggtggcagaagagcatgtcctgcagtatct 1419

                                                                   
Query: 189  tttggcctgcaaatggcacatttgacattggcaagtttattacaggcttttgaaa 243
            |||||||| ||||||   ||||| |||||||| |||||||| || ||||||||||
Sbjct: 1420 tttggcctccaaatgatgcatttaacattggccagtttattgcatgcttttgaaa 1474


>29929.m004802 cytochrome P450, putative
          Length = 627

 Score = 52.0 bits (26), Expect = 2e-06
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 136 attttgagttgttgccatttggaggtggaagaag 169
           |||||||||| ||||||||||||| |||||||||
Sbjct: 401 attttgagttattgccatttggagctggaagaag 434


>30170.m013964 cytochrome P450, putative
          Length = 1569

 Score = 50.1 bits (25), Expect = 9e-06
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                     
Query: 102  acgactcataaaaatgttgatgttagaggcaagaattttga 142
            |||||||||||| || |||||||||||||  ||||||||||
Sbjct: 1303 acgactcataaagattttgatgttagaggtcagaattttga 1343