Jatropha Genome Database

JcCB0181311.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0181311.10 + phase: 0 /partial
         (450 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29948.m000687 similarity to receptor protein kinase, putative         238   2e-62
29842.m003541 similarity to receptor protein kinase, putative          70   1e-11

>29948.m000687 similarity to receptor protein kinase, putative
          Length = 1812

 Score =  238 bits (120), Expect = 2e-62
 Identities = 177/196 (90%)
 Strand = Plus / Plus

                                                                       
Query: 255 tcctggaagtaactcagataaacctgtcgaatcaactggtctggcaccatctccgggcct 314
           |||||||||||||||||| || ||||| |||||||||||| ||||||||||||| || ||
Sbjct: 786 tcctggaagtaactcagacaagcctgtggaatcaactggtttggcaccatctccaggtct 845

                                                                       
Query: 315 tacaggcataactgtggacaaatcagtggagttttcttatgaagaacttgcccaggctac 374
           ||| |||||||| |||||||| ||||| || ||||| |||||||||||||||| ||||||
Sbjct: 846 tacgggcataaccgtggacaagtcagtcgaattttcatatgaagaacttgccctggctac 905

                                                                       
Query: 375 tgataacttcaatttggctaataagattggtcagggtggctttgggtctgtttactatgc 434
           ||||||||||| |||||||||||||||||| || ||||||||||||||||| ||||||||
Sbjct: 906 tgataacttcagtttggctaataagattggccaaggtggctttgggtctgtatactatgc 965

                           
Query: 435 agagctgagaggcgag 450
           ||| || |||||||||
Sbjct: 966 agaacttagaggcgag 981


>29842.m003541 similarity to receptor protein kinase, putative
          Length = 1824

 Score = 69.9 bits (35), Expect = 1e-11
 Identities = 101/123 (82%)
 Strand = Plus / Plus

                                                                       
Query: 328 gtggacaaatcagtggagttttcttatgaagaacttgcccaggctactgataacttcaat 387
           ||||||||||| |||||||| || ||||||||||||||  | |||||| || ||||||  
Sbjct: 871 gtggacaaatctgtggagttctcatatgaagaacttgctaatgctactaatgacttcagc 930

                                                                       
Query: 388 ttggctaataagattggtcagggtggctttgggtctgtttactatgcagagctgagaggc 447
            ||| |||||| ||||| || || |||||||| || || |||||||| || || ||||||
Sbjct: 931 atggttaataaaattgggcaaggaggctttggatcagtctactatgctgaactaagaggc 990

              
Query: 448 gag 450
           |||
Sbjct: 991 gag 993