Jatropha Genome Database

JcCB0174221.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0174221.20 - phase: 0 /partial
         (231 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29727.m000490 conserved hypothetical protein                          258   1e-68

>29727.m000490 conserved hypothetical protein
          Length = 3267

 Score =  258 bits (130), Expect = 1e-68
 Identities = 169/182 (92%)
 Strand = Plus / Plus

                                                                        
Query: 46   caggtatctgtttcactaatggagtcgggcaatccaccagaaaaacatgatgagttgatt 105
            ||||| ||||||||||| |||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 3079 caggtttctgtttcacttatggagtcgggcaatccaccagaaaaccatgatgatttgatt 3138

                                                                        
Query: 106  gaacttgttgcttgcccagatactgggtttctccatttgtttagtcagcaacaactgcag 165
            |||||||||||||||||||| |||||||| |||||||||||||||||||||||  |||||
Sbjct: 3139 gaacttgttgcttgcccagaaactgggttcctccatttgtttagtcagcaacagttgcag 3198

                                                                        
Query: 166  gaatttctattgtttgagagagaatattcaatatgcaaaatggagcttgaagagggactc 225
            |||||||||||||||||||||||||||||| ||  ||| |||||||||||||||| ||||
Sbjct: 3199 gaatttctattgtttgagagagaatattcagtagtcaagatggagcttgaagaggaactc 3258

              
Query: 226  tc 227
            ||
Sbjct: 3259 tc 3260