Jatropha Genome Database

JcCB0174101.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0174101.20 + phase: 0 /partial
         (678 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30158.m000505 protein phosphatase 2c, putative                         68   7e-11

>30158.m000505 protein phosphatase 2c, putative
          Length = 828

 Score = 67.9 bits (34), Expect = 7e-11
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                         
Query: 578 aagctggagatattgtagttgcaggaactgatggtttgcttgataa 623
           |||||||||||||||||||||||||||| ||||| | |||||||||
Sbjct: 560 aagctggagatattgtagttgcaggaacggatggatggcttgataa 605



 Score = 52.0 bits (26), Expect = 4e-06
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 154 agaccacaaggagaagacgctcattttatttgcaaagaaaag 195
           ||||||| ||||||||| ||||| ||| ||||||||||||||
Sbjct: 139 agaccactaggagaagatgctcactttgtttgcaaagaaaag 180