Jatropha Genome Database

JcCB0173711.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0173711.10 + phase: 2 /partial
         (523 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29999.m000206 arginine biosynthesis protein argJ 1, putative          494   e-139

>29999.m000206 arginine biosynthesis protein argJ 1, putative
          Length = 1410

 Score =  494 bits (249), Expect = e-139
 Identities = 452/517 (87%), Gaps = 2/517 (0%)
 Strand = Plus / Plus

                                                                        
Query: 1    tttggctagtgggttatctggatcaacctcaatatcatctatcgaatgcagtgaggcaag 60
            ||||||||||||  ||||||||||||  |||||||||||||| || ||||    ||| | 
Sbjct: 885  tttggctagtggactatctggatcaatgtcaatatcatctattgactgcacccgggccat 944

                                                                        
Query: 61   acaacttcaagcatgccttgatgcagtaatgcaagctcttgcaaaatcagtagcttggga 120
             ||||||||||| || |||||||| |||||||||| |||||| |||||| ||||||||||
Sbjct: 945  tcaacttcaagcgtgtcttgatgctgtaatgcaaggtcttgccaaatcaatagcttggga 1004

                                                                        
Query: 121  tggagaaggagctacatgcctaattgaggttacagtaactggggcagaaagcgaggtgaa 180
            ||| || |||||||| ||||| |||||||| |||||  | ||| |||| |||||||||||
Sbjct: 1005 tggggagggagctacctgccttattgaggtcacagtggcagggacagagagcgaggtgaa 1064

                                                                        
Query: 181  agctgcgaagattgcacgctctgtggcatcttcttcacttgtcaaggctgcagtatatgg 240
             || || |||||||||||||| ||||||||||||||||||||||||||||| || |||||
Sbjct: 1065 ggcagcaaagattgcacgctccgtggcatcttcttcacttgtcaaggctgctgtttatgg 1124

                                                                        
Query: 241  aagagatccaaattggggacgcattgctgccgccgccggctatgcagggattcctttcca 300
            |||||||||||||||||| || |||||||| || || |||||||||||||||||||||||
Sbjct: 1125 aagagatccaaattgggggcggattgctgctgctgctggctatgcagggattcctttcca 1184

                                                                        
Query: 301  ccagaacaacctccgggttatgcttggggatattttgctgatggataatggacagccgct 360
            ||||||||| || ||  || ||||||||||||||||||||||||||||||| || || ||
Sbjct: 1185 ccagaacaagctgcgcattttgcttggggatattttgctgatggataatggccaaccact 1244

                                                                        
Query: 361  tgcatttgatagggctgctgctagtaactatctcaggaaggctggtgaaacccatggaac 420
            ||||||||||||| ||||||||||||| ||||||| || |||||| || |||||||| ||
Sbjct: 1245 tgcatttgataggcctgctgctagtaaatatctcaagatggctggagagacccatggtac 1304

                                                                        
Query: 421  agttggaatttacatttctgttggtgatggatcaggacat-ggacaggcatggggctgcg 479
             |||  ||||||||||||||| |||||||||||||| ||| ||| ||||||||||||| |
Sbjct: 1305 tgttaaaatttacatttctgtaggtgatggatcagg-catcggaaaggcatggggctgtg 1363

                                                 
Query: 480  acttgagttatgattatgttaaaataaatgcagagta 516
            |||||||||| |||||||| |||||||||||||||||
Sbjct: 1364 acttgagttacgattatgtcaaaataaatgcagagta 1400