Jatropha Genome Database
- JcCB0173361.20
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0173361.20 + phase: 0 /partial
(859 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
29900.m001591 conserved hypothetical protein 98 1e-19
>29900.m001591 conserved hypothetical protein
Length = 159
Score = 97.6 bits (49), Expect = 1e-19
Identities = 61/65 (93%)
Strand = Plus / Minus
Query: 760 ttgatagaagaaggtgcagtagaattgatggtgccagggaacttaccaataggatgctct 819
||||||||||||||||||| |||| ||||||||||||||||||| ||||| |||||||||
Sbjct: 152 ttgatagaagaaggtgcagcagaagtgatggtgccagggaacttgccaatcggatgctct 93
Query: 820 gctgt 824
|||||
Sbjct: 92 gctgt 88