Jatropha Genome Database

JcCB0171801.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0171801.10 - phase: 0 
         (429 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29613.m000362 conserved hypothetical protein                          151   4e-36

>29613.m000362 conserved hypothetical protein
          Length = 462

 Score =  151 bits (76), Expect = 4e-36
 Identities = 169/200 (84%)
 Strand = Plus / Plus

                                                                       
Query: 208 ttagttgagaaacggtcacttcttcctccggtgacgaggaaatcggttttgctcaggcaa 267
           ||||| |||| | ||||||| ||||||  ||| || ||||| || || ||||| || |||
Sbjct: 241 ttagtggagagaaggtcactacttcctgtggttacaaggaagtctgtgttgcttagacaa 300

                                                                       
Query: 268 cttggcattggaagatcgcagcttagagcaagggatttcaagaataaatctgtctttgta 327
           ||||| ||||| || || ||||||||||| || ||| |||||||||| ||| || |||| 
Sbjct: 301 cttgggattgggaggtctcagcttagagccagagatatcaagaataagtctatccttgtt 360

                                                                       
Query: 328 gccattgagaagacatggcgtaagacattagaaggagcatcaagagtacttttggagaag 387
           ||| |||| ||||||||||| ||||||||||||||||| |||| ||||||||||||||||
Sbjct: 361 gcccttgaaaagacatggcgcaagacattagaaggagcttcaaaagtacttttggagaag 420

                               
Query: 388 cattataaccgacatagacg 407
           ||||| || |||||||||||
Sbjct: 421 cattacaatcgacatagacg 440



 Score = 69.9 bits (35), Expect = 1e-11
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                     
Query: 31 acagttcaacatgtgacgaagaagtcttctgatgagctgttgaggaaatttgcagaagt 89
          |||||||||||||| || ||||| |||||||||||| |  |||||||||||||||||||
Sbjct: 28 acagttcaacatgtaaccaagaaatcttctgatgagttactgaggaaatttgcagaagt 86