Jatropha Genome Database

JcCB0171671.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0171671.10 + phase: 1 /pseudo/partial
         (664 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29844.m003306 conserved hypothetical protein                           60   2e-08

>29844.m003306 conserved hypothetical protein
          Length = 909

 Score = 60.0 bits (30), Expect = 2e-08
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 330 cttgggggtggttacctttttgggttgcctgtaggatttgttgctgattctattggtgcc 389
           ||||| ||||| || || ||||| |||||||| || |||||||||||||| |||||||||
Sbjct: 298 cttggtggtggatatctctttggattgcctgtcggctttgttgctgattcaattggtgcc 357

             
Query: 390 ac 391
           ||
Sbjct: 358 ac 359